RESEARCH ARTICLE
Single-Cell Infection of Influenza A Virus Using Drop-Based
Microfluidics
Emma Kate Loveday,a,b Humberto S. Sanchez,a,b Mallory M. Thomas,a,c Connie B. Changa,b,d
aCenter for Biofilm Engineering, Montana State University, Bozeman, Montana, USA
bDepartment of Chemical and Biological Engineering, Montana State University, Bozeman, Montana, USA
cMicrobiology and Cell Biology, Montana State University, Bozeman, Montana, USA
dDepartment of Physiology and Biomedical Engineering, Mayo Clinic, Rochester, Minnesota, USA
ABSTRACT Drop-based microfluidics has revolutionized single-cell studies and can be
applied toward analyzing tens of thousands to millions of single cells and their products
contained within picoliter-sized drops. Drop-based microfluidics can shed insight into
single-cell virology, enabling higher-resolution analysis of cellular and viral heterogeneity
during viral infection. In this work, individual A549, MDCK, and siat7e cells were infected
with influenza A virus (IAV) and encapsulated into 100-mm-size drops. Initial studies of
uninfected cells encapsulated in drops demonstrated high cell viability and drop stability.
Cell viability of uninfected cells in the drops remained above 75%, and the average drop
radii changed by less than 3% following cell encapsulation and incubation over 24 h.
Infection parameters were analyzed over 24 h from individually infected cells in drops.
The number of IAV viral genomes and infectious viruses released from A549 and MDCK
cells in drops was not significantly different from bulk infection as measured by reverse
transcriptase quantitative PCR (RT-qPCR) and plaque assay. The application of drop-based
microfluidics in this work expands the capacity to propagate IAV viruses and perform high-
throughput analyses of individually infected cells.
IMPORTANCE Drop-based microfluidics is a cutting-edge tool in single-cell research.
Here, we used drop-based microfluidics to encapsulate thousands of individual cells
infected with influenza A virus within picoliter-sized drops. Drop stability, cell loading,
and cell viability were quantified from three different cell lines that support influenza
A virus propagation. Similar levels of viral progeny as determined by RT-qPCR and pla-
que assay were observed from encapsulated cells in drops compared to bulk culture.
This approach enables the ability to propagate influenza A virus from encapsulated
cells, allowing for future high-throughput analysis of single host cell interactions in iso-
lated microenvironments over the course of the viral life cycle.
KEYWORDS microfluidics, influenza, single cell, drops
Single-cell studies of viral infection enable high-resolution examination of heterogeneous
virus populations. Differential selective pressures in both the host cell and virus popula- Editor Abimbola O. Kolawole, Wright State
tion lead to variability in virus replication and production that enables antiviral escape, zoo- University
notic spillover events, and changes in virulence or pathogenesis (1). Influenza A virus (IAV) Copyright © 2022 Loveday et al. This is an
open-access article distributed under the terms
is a negative-strand RNA virus with populations containing high genetic diversity due to its of the Creative Commons Attribution 4.0
segmented genome, rapid replication rate, and low-fidelity RNA-dependent RNA polymer- International license.
ase (RdRp) (1). As such, IAV infection results in a diverse swarm of unique variants exhibiting Address correspondence to Connie B. Chang,
heterogeneous genotypes and phenotypes (2, 3). connie.chang@montana.edu.
Cutting-edge technologies such as drop-based micro uidics (4 8) and single-cell sequenc- The authors declare no conflict of interest.
fl –
Received 13 April 2022
ing (9–14) are enabling higher-resolution analysis of the effects of cellular heterogeneity on vi- Accepted 22 August 2022
ral infection dynamics. Single-cell virology studies have revealed a more detailed snapshot of Published 20 September 2022
the heterogeneous kinetics of virus production in relation to innate immune activation and
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 1
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
responses (15–18) and the variability of viral gene expression between individually infected
cells (9–12). Heterogeneous IAV populations can be examined using methods that capture
diversity at the single-cell level. Such methods include microfluidic techniques to perform
single-cell transcriptomics (9–11) or isolation of cells using limiting dilutions in well plates to
assess single infection events (12, 13, 16, 19) or by using two-dimensional (2D) microfluidic
chambers (15). While these studies have identified large variations in total viral mRNA
expressed, infectious virus produced, and host transcriptional response to infection, the
low-throughput methods were limited to analyzing hundreds to a few thousand individual
cells (12, 13, 15, 20). To process tens of thousands or up to millions of single cells, a high-
throughput continuous flow method such as fluorescence-activated cell sorting (FACS) can
be utilized to study virus infection (9–11, 14). Yet FACS sorting is mostly performed at early
time points postinfection to ensure that virus spread is reduced and that the timing of infec-
tion, viral gene expression, and cellular response to infection are comparable from cell to
cell (9–11, 14, 17). In contrast, analysis of infected cells from bulk cultures at later time points
postinfection can be difficult due to virus spread.
A method to study single cells at high throughput is drop-based microfluidics, which offers
the ability to compartmentalize and rapidly assay individual cells (6, 21–25). A microfluidic de-
vice is used to create microscale aqueous drops that are surrounded by an immiscible oil and
stabilized with a biocompatible surfactant (26). Compared to larger-scale in vitro culturing
methods where cells are grown in flasks or well plates, drop-based microfluidics creates mil-
lions of discrete bioreactors that house single cells in which viruses can replicate (4, 7), ena-
bling viral replication events to be analyzed independently. Furthermore, these compartmen-
talized cells in drops allow for single-cell analysis at any time point postinfection since virus
spread cannot occur between neighboring drops. Thus, drops provide a way to analyze virus
replication, production, and cellular responses of single cells at multiple time points.
To date, drop-based viral infections have only been performed with murine norovirus
(MNV-1), a positive-sense RNA virus in a small icosahedral capsid that lacks an outer envelope
and is extremely stable at a range of environmental conditions, using cell lines adapted to
spinner cultures or already grown in suspension (4, 7, 8, 27). Drop-based microfluidics was
used to study infectivity (4, 7) and recombination (8) of MNV-1, with data demonstrating the
ability to successfully encapsulate and infect mammalian cells within drops (4, 6–8). Expanding
the applicability of drop-based microfluidics to other viruses, specifically for enveloped viruses
such as IAV, and the ability to encapsulate a broad range of host cells would greatly increase
capacity for single-cell virology studies.
In this work, drop-based microfluidics was applied toward culturing and studying IAV
infections at the single-cell level. Three different cell lines, alveolar basal epithelial (A549)
cells, Madin-Darby Canine Kidney (MDCK) cells, and MDCK plus human siat7e gene (siat7e)
cells (28, 29), were tested for their viability and ability to support IAV infection in drops com-
pared to bulk tissue culture. Drop stability, cell loading, and viability were tested within 100-
mm-diameter drops and quantified after 24 h of incubation, sufficient time for one productive
round of IAV infection. Additionally, this study demonstrates the use of drop-based microflui-
dics to culture and propagate enveloped viruses, which generally have reduced environmental
stability. The cells were infected with A/California/07/2009 (H1N1) at a multiplicity of infection
(MOI) of 0.1 to compare virus production over multiple time points between infected cells on
standard tissue culture plates and encapsulated in drops. Our findings demonstrate that
standard adherent cell lines can be used in drops to propagate IAV, thereby expanding single-
cell capabilities for studying viral infections, which, until recently, has only been demonstrated
for nonadherent, spinner-adapted host cells (4, 7, 8).
The drop-based microfluidic methods developed in this work will enable future
studies of single-cell IAV infections using multiple cell lines. The methods expand the
application of drop-based microfluidics from the nonenveloped positive-sense MNV-1
(4, 7, 8) to include the enveloped and negative-sense IAV, thus broadening the scope
of single-cell virology assays. Additionally, this work can serve as a blueprint for testing,
comparing, and implementing drop-based microfluidics methods in future single-cell
studies. With the recent interest and development of single-cell omic technologies for
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 2
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
FIG 1 Graphical workflow. (A) Cells were infected with IAV. (B) A suspension of infected cells was encapsulated into drops using a fluorinated oil continuous phase.
(C) Drops were incubated for 24 h at 37°C and 5% CO2. (D) A portion of infected cells was replated onto standard tissue culture dishes to recapitulate a bulk
infection and incubated for 24 h at 37°C and 5% CO2. (E) To analyze virus production, the drops were broken and pooled, and cells and/or viral supernatant were
recovered. (F) Cells and virus from drop and bulk infections were analyzed using LIVE/DEAD staining to determine cell viability, RT-qPCR to determine viral genome
copy number, and plaque assays to determine viral infectivity.
studying viral infections (13–15, 20, 30–36), we expect this work to further expand
capabilities and increase applications of single-cell technologies in virology.
RESULTS
Single-cell virus infection using drop-based microfluidics. A schematic of the virus
infection workflow comparing drops to bulk is outlined in Fig. 1. Naive cells were infected
with IAV at an MOI of 0.1 prior to encapsulation such that most cells were infected with a
single infectious virus particle (Fig. 1A). Following inoculation, cells were dissociated from
the tissue culture plates and processed for encapsulation into 100-mm drops (Fig. 1B), while
bulk samples were replated (Fig. 1D). Both encapsulated and bulk cells were similarly proc-
essed to ensure that trypsinization from the tissue culture plates and subsequent centrifuga-
tion and washing did not interfere with infection kinetics. A 0 h bulk and drop sample was
obtained immediately following replating or encapsulation. The remaining bulk and drop
samples were incubated for 24 h at 37°C to allow for a minimum of one round of virus repli-
cation (Fig. 1C and D). At 24 hours post infection (hpi), viral supernatant was collected from
both the bulk and drop samples for analysis of viral genome copies and infectious progeny
via reverse transcriptase quantitative PCR (RT-qPCR) and plaque assay. To sample viral super-
natant from encapsulated infections, the drops were placed in the freezer and, after thaw-
ing, treated with 20% 1H,1H,2H,2H-perfluoro-1-octanol (PFO) in HFE7500 to break the emul-
sions and release the cells and viral supernatant for collection (Fig. 1E). To assess cell
viability, drops were not frozen and were broken with 20% PFO in HFE7500 only. We then
compared cell viability and number of viral genomes and infectious progeny from different
cell lines maintained in bulk culture and encapsulated in drops (Fig. 1F).
Validating IAV infection in different cell lines. Before performing IAV infection in
drops, IAV infection was studied in bulk using three different cell lines, A549, MDCK, and
siat7e cells. Both the A549 and MDCK cells are anchorage dependent and are commonly
used to propagate IAV and investigate viral infection phenotypes. The siat7e cells are a
modified MDCK cell line that expresses the siat7e gene (ST6GalNac V), which is important
for cellular adhesion, allowing the cells to grow in a suspension culture, and they are distinc-
tive from the standard MDCK-Siat1 cells used commonly for IAV production (28, 29). They
were developed to simplify cell culture-based IAV vaccine production (28, 29). The siat7e
cells are anchorage independent and were tested for their potentially more favorable com-
patibility to drop encapsulation (4, 7). IAV production was compared between the different
cell lines to determine the kinetics of viral infection in a bulk infection. The cells were
infected at an MOI of 0.1, and viral RNA was measured from supernatant at 0, 6, 12, 24, 30,
36, and 48 hpi using RT-qPCR, in which the 0 h measurement represents the inoculating
dose (Fig. 2A to C). A549 cells demonstrated the most robust viral RNA production during
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 3
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
FIG 2 IAV infection in different cell lines. IAV genomes, as measured by RT-qPCR over 48 hpi from
supernatant of infected A549 (A), MDCK (B), and siat7e (C) cells. All data represent the mean 6 SD of a
minimum of three independent replicates.
infection, with 9.5 
 104 genome copies/mL at 0 hpi, which increased to 3.9 
 108 genome
copies/mL at 24 hpi, a 1,000-fold increase. Between 24 and 48 hpi, the amount of RNA detected
fluctuated slightly but remained between 1.6 and 6.1 
 108 genome copies/mL. MDCK cells
demonstrated a slower increase in viral production, with 1.1
 105 genome copies/mL at 0 hpi,
increasing to 3.5 
 107 genome copies/mL at 24 hpi, a 100-fold increase, before reaching
1.9
 108 genome copies/mL at 48 hpi. IAV production in siat7e cells was limited with no expo-
nential increase over the course of 48 hpi, with 6.0 
 105 genome copies/mL at 0 hpi and
5.4
 106 genome copies/mL at 48 hpi. For A/California/07/2009, peak hemagglutinin (HA) titers
in siat7e cells were previously observed at 24 hpi, although 50% tissue culture infective dose
(TCID50) measurements showed similar kinetics to our observed viral RNA measurements, with
limited increases in titers from 0 to 120 hpi, suggesting that replication and production of infec-
tious virus in the siat7e cells is limited (29). In addition, viral growth, as measured by TCID50, of
A/Brisbane/59/2007 IVR-148 (H1N1) and A/Uruguay/716/2007 X-175C (H3N2) in the siat7e cells
was also not observed until 96 and 84 h, respectively, suggesting that there is variability in viral
replication and kinetics in the siat7e cells (11). Overall, the average genomes/mL for A549,
MDCK, and siat7e cells from 6 to 48 hpi, the time frame that represents active IAV production,
was 2.6 
 108, 6.4 
 107, and 2.9 
 106 genome copies/mL, respectively, demonstrating cell
type-dependent differences in IAV production.
Drop stability and cell viability during incubation. To perform long-term infection
studies of viral infection in drops, drops must remain stable against coalescence, and
cells must remain viable to propagate virus. Therefore, drop radii and cell viability over
24 h were first quantified before performing viral infection experiments. The A549,
MDCK, and siat7e cells were encapsulated in 100-mm drops and incubated for 24 h.
Drop radii (R) were measured following encapsulation at 0 h and after incubation of all
three cell lines at 24 h (Fig. 3A). For A549 cells, the average R at 0 h was 45.1 mm with a
95% confidence interval (CI) of 35.9 to 54.3 mm, which decreased by 0.9 mm to 44.2 mm,
with a 95% CI of 0.9 to 0.7 mm after incubation for 24 h. For MDCK cells, the average R at 0
h was 44.6 mm with a 95% CI of 35.3 to 53.9 mm, which increased by 1.3 mm to 45.9 mm
with a 95% CI of 1.2 to 1.5mm after incubation for 24 h. For the siat7e cells, the average R at
0 h was 44.8 mm with a 95% CI of 35.5 to 54.2 mm, which increased by 0.7 mm to 45.5 mm
with a 95% CI of 0.6 to 0.9 mm after incubation for 24 h. A linear mixed-effects model was
used to determine if there was a significant change in R as a function of the cell type or
time point postencapsulation. The change in R from 0 to 24 h following encapsulation of ei-
ther A549 or MDCK cells was considered significantly different (P # 0.001 for both), while
the change in drop R from encapsulated siat7e cells was not significant (P = 0.323).
However, since the changes in R for both cell lines are less than 3% of the original drop sizes
and correspondingly less than the camera resolution of 1.6 mm/pixel, these data indicate
that cell incubation does not have a meaningful impact on changes in drop stability as
measured by R. Representative images of encapsulated A549 cells at 0 h (Fig. 3B) and 24 h
(Fig. 3C) demonstrate this drop stability.
To assess cell viability, drops containing cells were broken after 24 h of incubation,
and the aqueous layer which contained the cells was collected and analyzed with a colori-
metric cell viability stain and by FACS analysis. Following staining and counts of the cells
using a hemacytometer, each of the three cell lines showed cell viability over 75%. Average
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 4
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
FIG 3 Drop stability in 100-mm microfluidic drops. (A) Drop radii (R) of encapsulated A549 (n = 4,067),
MDCK (n = 4,235), and siat7e (n = 3,858) cells at 0 and 24 h. Representative images of A549 cells
encapsulated in drops at 0 h (B) and 24 h (C). Scale bars, 100 mm.
live cell viability percentages were 76.2 6 7.6% for A549 cells, 89.3 6 4.6% for MDCK cells,
and 90.6 6 3.5% for siat7e cells. FACS analysis was used to quantify cell viability of a larger
population of cells incubated in drops for 24 h (Fig. 4B to D). Cells were stained with propi-
dium iodide to identify apoptotic cells within the population. A minimum of 10,000 cells
were analyzed. The percentage of viable A549 cells following drop incubation was 83.1%.
For MDCK cells, the percentage of viable cells was 90.7%, while viability of the siat7e cells
was 94.5%. For all three cell lines, the percentage of viable cells determined by FACS was in
the margin of error for the values determined by trypan blue staining.
The high cell viability observed in the siat7e cells was expected due to the cells
being nonadherent with fewer physiological changes when encapsulated within drops.
While the viability of the A549 cells was less than that observed in the MDCK and siat7e
cells in drops, there was not a significant difference. We hypothesize that the differences
observed in viability between the adherent A549 and MDCK cells were due to inherent differ-
ences between the cells themselves. MDCK cells are more prone to overgrowing and detach-
ing from tissue culture flasks. They do not display strong contact inhibition andmay be slightly
better suited for drop encapsulation. In comparison, A549 cells demonstrate strong contact in-
hibition and rarely detach from tissue culture flasks. These inherent differences may impact
cell viability following encapsulation into microfluidic drops.
Cell loading in microfluidic drops. For single-cell studies, each drop should be
loaded with one cell. The number of cells loaded into drops can be estimated using a
Poisson distribution (37) as follows:
k 2l
pðk; lÞ ¼ l e
k!
where p is the probability of finding k cells per drop, k is the number of cells per drop, and
l is the mean number of cells in the volume of each drop. The l is calculated by multiplying
the starting cell density by the volume of a drop (22). Based upon Poisson statistics, loading
cells at a density of 2 
 106 cells/mL into 100-mm drops should result in a l of 1.0, with 37%
of drops containing no cells, 37% of drops containing one cell, 18% of drops containing two
cells, 6% of drops containing three cells, and 1.9% of drops containing four or more cells. To
check if the three cell lines followed the predicted Poisson distribution, cells were loaded at a
density of 2 
 106 cells/mL, and cell counts were made using still images of drops loaded
onto a hemocytometer (Fig. 5A and B). Our calculated distribution did not follow expected
Poisson statistics. The observed cell loading distributions for all three cell lines were much
lower than expected. The percentages of drops that contained either 0, 1, 2, 3, or 41 cells per
drop were determined to understand how well the cell loading followed the predicted
Poisson distribution. A549 cells had 10.8 6 1.8% of total drops containing one cell from the
images acquired on the hemocytometer, compared to the predicted 37% (Fig. 5C). MDCK cells
had 8.06 4.0% of total drops containing one cell (Fig. 5D), and siat7e cells had 5.76 1.9% of
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 5
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
FIG 4 Cell viability in 100-mm microfluidic drops. (A) A549, MDCK, and siat7e cell viability at 24 h postencapsulation as determined by
trypan blue staining, represented by the mean 6 standard error of the mean (SEM). Points represent individual experiments. (B to D) FACS
analysis of cell viability for A549 (B), MDCK (C), and siat7e (D) cells. The line on the histogram indicates the gating strategy to identify
apoptotic cells.
total drops containing one cell on the hemocytometer (Fig. 5E). The percentage of loaded
drops that contained a single cell only was also calculated. For A549 and MDCK cells, 68% and
73% of loaded drops contained a single cell, respectively (Table 1). For siat7e cells, only 38% of
loaded drops contained a single cell (Table 1). With lower than expected cell loading data, we
recalculated l based on the experimentally determined loading distribution to accurately cal-
culate the concentration of cells loaded into drops, not just added to the syringe for encapsu-
lation. Based upon the experimental loading distribution, l for each cell line was calculated
using a Poisson mixed-effects model. The l values correspond to starting cell concentrations
that were lower than the input concentration of 2 
 106 cells/mL. The A549 cells had a l
of 0.282, which corresponds to an estimated cell concentration of 2.80 
 105 cells/mL. The
MDCK cells had a l of 0.164, which corresponds to an estimated cell concentration of
3.19 
 105 cells/mL. The siat7e cells had a l of 0.382 and an estimated cell concentration
of 3.85
 105 cells/mL. We hypothesize that the discrepancy between the starting cell concen-
tration and observed loading distribution was most likely due to cell settling in the syringe
during loading and cell adherence to the filter upstream of the flow-focusing junction. The
theoretical Poisson distributions that correspond to the calculated l values for each cell line
were determined (Fig. 5C to E). A chi-square analysis was used to evaluate how the actual
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 6
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
FIG 5 Cell encapsulation in microfluidic drops. (A) Still image of high-speed camera footage during
cell encapsulation. The image has been modified to cover lithography marks outside the channels for
aesthetics. (B) Representative image of drops encapsulated onto a hemocytometer. (C) A549 cell
loading as measured with the hemocytometer (red circle, n = 600) compared to the theoretical
Poisson distribution (peach square). (D) MDCK cell loading as measured with the hemocytometer
(aqua circle, n = 601) compared to the theoretical Poisson distribution (green square). (E) Siat7e cell
loading as measured with the hemocytometer (light gray circle, n = 598) and compared to the
theoretical Poisson distribution (white square). Data points are represented by the mean 6 SD. All
scale bars are 100 mm.
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 7
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
TABLE 1 Percentage of cells/drop in loaded drops containing cells
Cell type % 1 cell/drop % 2 cells/drop % 3 cells/drop % 4+ cells/drop
A549 67.6 18.2 5.1 9.1
MDCK 72.9 14.9 6.0 6.2
siat7e 36.5 15.5 6.2 41.8
distribution of cells in drops compared to the theoretical Poisson distributions. A higher P
value indicates a lack of evidence that the measured distribution does not follow a Poisson dis-
tribution. The A549 cells had the highest P value of 0.70, while the MDCK cells had a P value
of 0.48. The drops containing the siat7e cells had the lowest P value of 0.15, suggesting that
the distribution of siat7e cells in drops was the least representative of a Poisson distribution
out of the three cell lines. Overall, the siat7e cells demonstrated the greatest variability and
unpredictability in cell loading. We hypothesize that this is due to the cells adhering together,
which is also visible during normal cell growth in a shaker flask in which large clumps of cells
arise during growth. Due to poor cell encapsulation and low IAV replication during infection,
siat7e cells were excluded from further analysis.
IAV propagation in microfluidic drops. Following analysis of cell encapsulation
and viability of A549 and MDCK cells, IAV propagation was compared between A549 and
MDCK cells in bulk and in drops. A549 and MDCK cells were infected at an MOI of 0.1 with the
A/California/07/2009 (H1N1) IAV strain. To quantify the increase in virus genomes and infec-
tious progeny for both bulk and drop infections at 0 and 24 hpi, viral RNA was measured
using RT-qPCR, and infectious virus output was measured using plaque assay. Measurements
were taken at 0 and 24 hpi to limit detection of secondary spread within bulk cultures, as a
single round of replication occurs between 16 and 24 hpi (38). For A549 cells, the number of
genome copies/mL in drops, as measured by M gene RNA copy number using RT-qPCR, was
2.3 
 105 genome copies/mL at 0 h and increased to 2.3 
 107 genome copies/mL at 24 h
(Fig. 6A). Bulk infections of A549 cells had a comparable increase, with 1.8
 106 genome cop-
ies at 0 h and 5.6 
 108 genome copies/mL at 24 h (Fig. 6A). The log RNA concentrations in
drops compared to bulk at 0 h and 24 h were significantly different (P = 0.0006 and
P = 4.3E-09, respectively), which we hypothesize is due to a lower number of total
cells loaded into drops during encapsulation as described in “Cell loading in micro-
fluidic drops” than cells seeded on tissue culture plates. While this was not seen in
the analysis of infectious virus (PFU/mL) for A549 cells (P = 0.31 for 0 h and P = 0.71
for 24 h) (Fig. 6B), it was observed for both RNA (P = 7.2E-05 for 0 h and P = 0.0002
for 24 h) and PFU/mL for MDCK cells (Fig. 6C and D). However, the log difference of
viral genomes produced by cells from 0 to 24 h in drops compared to cells in bulk
was not significant (P = 0.057) and suggests that overall virus production was not
impacted by cell encapsulation. Recovery of infectious virus from A549 cells over the
same 24-h incubation period was not significantly different (P = 0.84) between IAV
infection in drops and bulk culture with 1.1 
 105 PFU/mL and 3.6 
 105 PFU/mL
recovered at 24 hpi, respectively (Fig. 6B).
For MDCK cells, the number of genome copies in drops was 8.9 
 103 genome copies/mL
at 0 h and increased to 2.3 
 107 genome copies/mL at 24 h, whereas bulk infections of
MDCK cells increased from 1.2
 105 genome copies/mL at 0 h and 3.4
 108 genome copies/
mL at 24 h (Fig. 6C). Similar to A549 cells, the overall log difference of viral genomes produced
by cells from 0 to 24 h was not significantly different (P = 0.6) between drop and bulk infec-
tion. Recovery of infectious virus from MDCK cells over 24 h in drops was 2.6 
 103 PFU/mL,
while bulk infections produced 1.0 
 106 PFU/mL (Fig. 6D). In contrast to A549 cells, the log
PFU/mL concentrations measured in MDCK cells in drops compared to bulk at 0 h and 24 h
were significantly different (P = 0.0004 and P = 0.003, respectively); however, this did not trans-
late into a significant difference in the change in log PFU/mL concentration from 0 to 24 h
between drop and bulk infections. The PFU-to-genome ratio for MDCK cells was 1 PFU per
5.81 
 103 genomes in drops and 1 PFU per 3.24 
 102 genomes in bulk. In comparison, for
A549 cells, the PFU-to-genome ratio results in 1 PFU per 2.97 
 102 genomes in drops and 1
PFU per 1.63
 103 genomes in bulk.
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 8
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
FIG 6 Comparison of drop and bulk IAV infections in A549 and MDCK cells. (A) RNA copy number of A/California/07/
2009 (H1N1) IAV in A549 cells infected at an MOI of 0.1 at 0 hpi in drops (red small dots), 24 hpi in drops (red large
dots), 0 hpi in bulk (red squares), and 24 hpi in bulk (red stripe). (B) Infectious virions (PFU/mL) released from A549
cells at 0 hpi in drops (peach small dots), 24 hpi in drops (peach large dots), 0 hpi in bulk (peach squares), and 24
hpi in bulk (peach stripe). (C) RNA copy number of A/California/07/2009 (H1N1) IAV in MDCK cells infected at an MOI
of 0.1 at 0 hpi in drops (aqua small dots), 24 hpi in drops (aqua large dots), 0 hpi in bulk (aqua squares), and 24 hpi
in bulk (aqua stripe). (D) Infectious virions (PFU/mL) released from MDCK cells 0 hpi in drops (green small dots), 24
hpi in drops (green large dots), 0 hpi in bulk (green squares), and 24 hpi in bulk (green stripe). All data represented
as mean 6 the SD with a minimum of three independent experiments. Significance is based upon a two-tailed t test
(**, P , 0.01; ***, P , 0.001; ns, not significant).
DISCUSSION
The drop-based microfluidic methods developed in this work will enable future studies
of single-cell IAV infections using multiple cell lines. The methods expand the application of
drop-based microfluidics from the nonenveloped, positive-sense MNV-1 (4, 7, 8) to include
the enveloped and negative-sense IAV, thus broadening the scope of single-cell virology
assays. Additionally, this work can serve as a blueprint for testing, comparing, and imple-
menting drop-based microfluidics methods in future single-cell studies. With the recent in-
terest and development of single-cell omic technologies for studying viral infections (13–15,
20, 30–36), we expect this work to further expand capabilities and increase applications of
single-cell technologies in virology.
To successfully perform in drop infections, standard cell lines used for propagating
viruses need to remain viable, and this depends upon both drop size and cell type.
Previous studies exploring viability of cells in drops found that smaller drop sizes resulted
in low levels of cell viability, even after a couple of hours, which is most likely due to a lack
of enough nutrients or buildup of waste products within the drops (39). Here, we demon-
strate that 100-mm-diameter drops yielded high cell viability and drop stability following
24 h of incubation. Cell viability of A549, MDCK, and siat7e cells in 100-mm drops remained
high (.75%), and the average drop radii changed by less than 3%. High cell viability was
expected from the siat7e suspension cell line, which was found to have a mean of 91%.
Though more variable between experimental replicates compared to the siat7e cells, the
adherent A549 and MDCK cell lines still demonstrated high cell viability (Fig. 3D).
To analyze the distribution of cells in drops, we used a hemocytometer to deter-
mine cell loading distributions. A concentration of 2 
 106 cells/mL was calculated to
obtain a maximum number of 100-mm diameter drops that contain a single cell based
upon Poisson loading. However, throughout our experiments, cells settled in the
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 9
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
syringes and attached to the aqueous-stream filter on the microfluidic drop maker,
lowering the number of cells being encapsulated. Therefore, the average number of
cells per drop volume, as described by l in our experiments, corresponded to a lower
cell concentration on the order of 105 cells/mL. One option to reduce cell settling is
the use of density-matched medium cells during encapsulation with a biologically inert
polymer, such as OptiPrep (40). This would decrease the settling velocity of a cell as
estimated using Stokes’ law (40). However, cell media components would have to be
further optimized, as increases in OptiPrep concentration also decrease cell viability
(40). Alternatively, a larger vessel in which cells are constantly stirred and then pneu-
matically transferred into the microfluidic device would also decrease cell settling.
Finally, cell adherence to the upstream filter was caused by clumps of cells, likely free
DNA and cell debris released during cell lysis. A reduction in shear stress that the cells
experience by using gentle pipetting or syringe loading would aid in reducing cell de-
bris. Cell adherence to device structures can be reduced by eliminating the filter struc-
tures or increasing the gaps between the pillars within the microfluidic device.
While cell settling impacted the cell loading concentration, the majority of our loaded
drops still contained a single cell. Surprisingly, the suspension siat7e cell line had the
largest variation from the expected Poisson distribution, with more drops having four or
more cells/drop than was observed for A549 or MDCK cells. We hypothesize that this
large variation was due to the siat7e cells adhering to each other when cultured in a
spinner flask and during infection prior to cell loading. To improve cell loading, a higher
concentration of cells can be used, although previous analysis of 2 
 106, 4 
 106, and
8 
 106 cells/mL in 50-mm drops had similar loading distributions (4). Thus, we conclude
that cell loading depends on the cell type, with adherent A549 and MDCK cells resulting
in a majority of single cells loaded into drops compared to the suspension siat7e cells.
Following our success in encapsulation and culturing multiple cell lines within
microfluidic drops, we investigated whether infected cells produce virus following
encapsulation compared to bulk studies. Due to the highly variable cell loading and
low virus production observed in the siat7e cells, only the A549 and MDCK cells were
utilized for drop infection experiments. Measurements of viral RNA via RT-qPCR and in-
fectious progeny via plaque assay were made at 0 and 24 h from supernatant collec-
tion from broken drops and compared to standard bulk infections on well plates. The
amount of virus produced from A549 and MDCK cells between 0 and 24 h in bulk was
not significantly different than the amount of virus produced from cells in drops. This
demonstrates that microfluidic drops can be used to propagate IAV from individual
cells and that standard adherent cell lines can be used without the need to adapt ad-
herent cells to suspension cultures. To further evaluate single-cell kinetics of infection,
multiple time points could be analyzed from infected cells in drops. One proposed
method for performing this analysis is the use of fluorescent protein (FP) expression
from specific viral or cellular gene targets. This would allow for continuous observa-
tions of cells in drops over time while quantifying changes in FP expression that corre-
late with virus replication or transcription. Time-resolved control using drops could
expand the capabilities of previous work in which fluorescent proteins expressed by
herpes simplex virus 1 were used to isolate infected cells at 5 hpi for downstream single-cell
RNA sequencing (scRNA-seq) (14). This work lays the foundation to expand methods for
investigating the heterogeneity within population dynamics at the single-cell level.
One concern regarding incubating viruses in drops is the transfer of viruses between
drops and the potential loss of infectious virus upon drop breaking. The surfactant that is
used to stabilize the drops is a mixture of di-block and tri-block polymers with fluorinated
tails that extend into the oil phase and hydrophilic blocks that extend into the aqueous
phase that are PEGylated (26). Polyethylene glycol (PEG) prevents most biological materials
from interacting with the drop interface and diffusing between neighboring drops. Small
molecules (water, amino acids, ions, and some antibiotics) have been known to diffuse
between neighboring drops (41–43); however, under our drop conditions, we empirically
observe that viruses do not cross the drop interface.
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 10
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
Conclusions. Analysis of individually infected cells has revealed the complexity and
heterogeneity of viral infections (9–11, 20). The implementation of current omics tech-
nologies in these systems has demonstrated that viral infections are as heterogeneous and
complex at the single-cell level as they are at the systems level (23–25). The application of
new technologies for the study of virology can elucidate how individual host cells influence vi-
ral evolution and respond to infection through the innate and adaptive immune systems.
Considering the current COVID-19 pandemic and the emergence of multiple variants within
the viral population, it is critical to expand our ability to study of how these variants arise, how
they operate under selective pressures, and how they impact transmission and virulence (44).
Single-cell studies can be limited by low-throughput analysis, reliance on expensive cell-sorting
machinery, and genetic manipulation of the virus itself. The use of drop-based microfluidics
can expand single-cell studies, offering the ability to perform high-throughput analysis of indi-
vidually infected cells (5, 21, 31). Advantageously, these applications can be adapted to many
laboratories with minimal investment. The ability to expand single-cell analysis using drop-
based microfluidics has the potential to revolutionize the field of virology.
MATERIALS ANDMETHODS
Cells and viruses. Human alveolar epithelial cells (A549), Madin-Darby canine kidney cells (MDCK),
and MDCK plus human siat7e gene (siat7e) cells were obtained from ATCC (CCL-185, CCL-34) and Joseph
Shiloach (NIH), respectively (28, 29). A549 cells were propagated in Hams F-12 (Corning) medium supplemented
with 10% fetal bovine serum (HyClone) and 1
 penicillin-streptomycin (Fisher Scientific). MDCK and siat7e cells
were propagated in Dulbecco’s modified Eagle medium (DMEM; Corning) supplemented with 10% fetal bovine
serum (HyClone) and 1
 penicillin-streptomycin. The IAV virus strain A/California/07/2009 (H1N1) was obtained
from Christopher Brooke (University of Illinois Urbana-Champaign [UIUC]). Stocks of A/California/07/2009 were
propagated, and we determined their titer on MDCK cells.
Microfluidic device fabrication.Microfluidic devices for drop making were fabricated by patterning
SU-8 photoresist (Microchem; catalog no. SU-8 50) on silicon wafers (University Wafer; ID no. 447; test grade) to
create 100-mm-tall and 100-mm-wide channels. Polydimethylsiloxane (PDMS) (Sylgard 184) was poured onto
the wafers at a 10:1 mass ratio of polymer to cross-linking agent according to standard photolithography tech-
niques (45). Air was purged from the uncured PDMS by placing the filled mold in a vacuum chamber for at
least 1 h. The PDMS was cured in an oven at 55°C for 24 h, and ports were punched into the PDMS slab with a
0.75-mm-inside-diameter biopsy specimen punch (EMS Rapid-Core; Electron Microscopy Sciences). The PDMS
slab was bonded to a 2-in. by 3-in. glass slide (VWR; microslides, catalog no. 48382-179) after plasma treatment
(Harrick Plasma; catalog no. PDC-001) for 60 s at high power (30 W) and 700 mtorr oxygen pressure. The drop-
making devices were made hydrophobic by flowing Aquapel (Pittsburgh Glass Works) through the channels,
followed by blowing the channels with air filtered through a GVS Abluo 25-mm 0.2-mm filter (Fisher Scientific)
before baking the devices in an oven at 55°C for 1 h.
Cell encapsulation in drops. Cells were seeded onto T25 asks or 6-well plates at a density of 1 
 105fl
cells/cm2 and incubated overnight. Cells were prepared for encapsulation by washing 2
 with phosphate-buf-
fered saline (PBS) followed by trypsinization to remove cells from the surface of the flasks or plates. The appro-
priate culture media containing 10% fetal bovine serum (FBS) were added to the cells to neutralize trypsiniza-
tion, and cells were collected and centrifuged at 500
 g for 5 min. The cell pellet was gently washed with 3 to
5 mL of PBS and centrifuged a second time at 500 
 g for 5 min. The cell pellets were gently resuspended in
FBS-free media to reach 2
 106 cells/mL in their designated media. We placed 10mL of cells on a hemocytom-
eter to visualize and confirm cell concentration and verify the presence of mostly single cells. Cells were loaded
into a 3-mL syringe (BD) for injection onto a flow-focusing microfluidic device for encapsulation into 100-mm
drops (;523 pL) (46). Drops were stabilized in a fluorinated HFE7500 oil (3 M) continuous phase with a 1.5%
(wt/wt) solution of PEG-PFPE2-based surfactant (RAN Biotechnologies; 008-FluoroSurfactant). The fluids were
transferred into the microfluidic device with syringe pumps (New Era NE-1000) controlled by a custom LabVIEW
(2015) program at flow rates of 1,000mL/h for the aqueous phase and 3,000mL/h for the oil phase. A 1,500-mL
total volume consisting of 375 mL of drops containing cells and 1,125 mL of oil was collected in a 2-mL micro-
centrifuge tube (Eppendorf). Following encapsulation, drops containing cells were incubated in an open micro-
centrifuge tube covered with parafilm at 37°C with 95% relative humidity and 5% CO2. Cells were released from
drops by removing most of the oil phase and then adding 1 mL of a 20% wt/wt 1H,1H,2H,2H-perfluoro-1-octa-
nol (PFO) in HFE7500 oil to break the emulsion, followed by vortexing. Centrifugation at 500 
 g for 5 min was
used to separate the aqueous cell suspension from the oil phase to isolate cells for further analysis.
Dropmeasurements. Drop radii were measured after imaging a drop monolayer on a hemocytome-
ter with a charge-coupled-device (CCD) camera (Flir Grasshopper3) on an inverted microscope (Nikon Ti-U). A
monolayer of drops with minimal packing density is viewed using a hemocytometer so that the drops remained
spherical for image analysis. A customMATLAB script was used to determine the drop radii, R, at 0 h and 24 h af-
ter the cells were incubated. Six images of drops, with a minimum of 300 drops per image per time point, were
analyzed. A data set containing R values at 0 and 24 h post encapsulation, the encapsulated cell line, and experi-
mental dates was created to analyze changes in R. A linear mixed-effects model, with the experimental date as a
random factor, was used to analyze the contributions of cell type and time point to the data set.
Cell loading and viability. The distribution of cells per drop was determined using still images of a
drop monolayer on a hemocytometer as described in “Drop measurements.” These distributions were fit to a
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 11
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
Poisson mixed-effects model with cell lines as the fixed effect and date as the random effect (47, 48). We used
a Pearson chi-square goodness-of-fit test to determine whether the observed data did not fit the theoretical
distribution. Following encapsulation, drops were incubated at 37°C with 95% relative humidity and 5% CO2.
Cells were released from drops as previously described. The cells in the aqueous phase were collected and pel-
leted at 1,500 
 g for 5 min. The cell pellet was resuspended in 200mL PBS. Cells were diluted 1:5 in PBS with
10% trypan blue stain for a final volume of 50 mL to determine cell viability. An unpaired t test was used to
determine if cell viability was significantly different between the cell lines. Flow cytometry (FACS) analysis was
performed on cells isolated as described above and resuspended in PBS with 2% FBS and 5mg/mL propidium
iodide (Sigma-Aldrich; catalog no. 537060) to stain apoptotic cells. Samples were analyzed with a BD
LSRFortessa flow cytometer (BD Biosciences) and FlowJo software (Tree Star).
IAV infection of adherent cells (A549 and MDCK). Cells were seeded onto a 6-well plate at a con-
centration of 1 
 106 cells/well and infected with IAV H1N1 at an MOI of 0.1 based upon plaque assay titering
in infection media. The infection media consisted of Hams F-12 or DMEM supplemented with 1 mM HEPES
(HyClone), 1
 penicillin-streptomycin, 0.1% bovine serum albumin (BSA) (MP Biomedical), and 1 mg/mL of
tosylsulfonyl phenylalanyl chloromethyl ketone (TPCK)-trypsin (Worthington Biomedical) (49). Briefly, cells were
washed with 1
 PBS (Corning) and incubated with 200 mL of virus inoculum for 1 h. The inoculum was
removed and replaced with 1.5 mL fresh infection medium for another 1 h of incubation. Infection medium
was removed, cells were washed with PBS, and the infected cells were detached from the plate by trypsiniza-
tion. Infected cells were processed as described in “Cell encapsulation in drops” and resuspended in encapsula-
tion media containing either Hams F-12 or DMEM and 1 mM HEPES, 1
 penicillin-streptomycin, and 0.1% BSA.
The infected cell suspension was split into two populations, with one population replated as a bulk control
and the other encapsulated in 100-mm drops. Bulk and drop infections were incubated at 37°C with 95% rela-
tive humidity and 5% CO2 and frozen at220°C at 0 and 24 h postinfection (hpi).
IAV infection of suspension siat7e cells. To infect the siat7e suspension cells at an MOI of 0.1 based
upon plaque assay titering, 1
 107 cells were pelleted at 500
 g for 5 min in a 50-mL conical centrifuge tube
and then resuspended in 200 mL of virus inoculum in DMEM supplemented with 1 mM HEPES (HyClone), 1

penicillin-streptomycin, 0.1% BSA, and 1 mg/mL of TPCK-trypsin (49). The 50-mL tube containing the cells and
virus inoculum was shaken at 90 rpm for 1 h. The cells were pelleted at 500 
 g for 5 min, and the inoculum
was removed and replaced with fresh DMEM infection media (10 mL) for bulk infections or DMEM encapsula-
tion media as described in “IAV infection of adherent cells (A549 and MDCK).” Infected cells were either encap-
sulated in 100-mm drops or replated as a bulk control. For bulk infections, a 1-mL volume of cells was added
to each well of a 6-well plate (2 total) and placed on the shaker. Encapsulated cells were processed as
described in “Cell encapsulation in drops.” Bulk and drop infections were incubated at 37°C with 95% relative
humidity and 5% CO2 and frozen at220°C at 0 and 24 hpi.
M gene abundance by RT-qPCR. RNA was extracted from cell suspensions using the Qiagen
QIAamp viral RNA minikit. RNA copy number of the IAV matrix protein gene (M gene) was determined using a
TaqMan RT-qPCR assay (5). Amplification primer sequence was originally described by Shu et al. (50) as follows: M
gene forward, 59-GACCRATCCTGTCACCTCTGAC-39, and M gene reverse, 59-AGGGCATTCTGGACAAATCGTCTA-39.
The sequence of the M gene TaqMan probe was 59-/FAM/TGCAGTCCTCGCTCACTGGGCACG/BHQ1/-39. Working
stocks of the primers and probe (Eurofins Operon) were prepared at 25 mM and 10 mM, respectively, for use in
the RT-qPCR. Samples were amplified using a SuperScript III Platinum one-step RT-qPCR kit (Invitrogen; catalog no.
11732-020) with a final reaction volume of 25 mL. Each reaction mix contained 400 nM M gene forward and
reverse primers, 200 nM M gene TaqMan probe, 0.05 mM ROX reference dye, 5 U/mL Superase RNase inhibitor
(Invitrogen; catalog no. AM2694), and 2.5 mL of RNA template. Thermocycling was performed in an RT-qPCR
machine (QuantStudio 3; Applied Biosystems) with the following cycling conditions: 1 cycle for 30 min at 60°C,
1 cycle for 2 min at 95°C, and 40 cycles between 15 s at 95°C and 1 min at 60°C.
Plaque assay. Postinfection IAV titers were determined by plaque assay on MDCK cells seeded in 6-
well plates at 1 
 106 cells per well. For drop infections, the viral supernatants were sampled from bro-
ken drops at 0 and 24 hpi. For bulk infections, viral supernatants were sampled from the tissue culture
plate wells at 0 and 24 hpi. The supernatants were serially diluted in DMEM media with 1 mM HEPES
(HyClone), 1
 penicillin-streptomycin, 0.1% BSA, and 2 mg/mL of TPCK-trypsin. Overlay medium consist-
ing of 2
 MEM with 2
 penicillin-streptomycin, 1 mM HEPES, 2 mg/mL of TPCK, and 3% carboxymethyl
cellulose (MP Biomedical) with 0.2 mg/mL DEAE-dextran (MP Biomedical) was added, and well plates
were incubated at 37°C for 4 days. Plaques were fixed with 10% buffered formalin (Fisher), washed with
deionized (DI) water, and stained with 0.5% crystal violet (Thermo Fisher Scientific) for visualization.
ACKNOWLEDGMENTS
This work was supported by the Defense Advanced Research Projects Agency (DARPA)
grant W911NF-17-2-0034, National Institute of Allergy and Infectious Diseases (NIAID) of the
National Institutes of Health (NIH) under award number 1R56AI156137, and National Science
Foundation (NSF) CAREER grant 1753352.
We thank Chris Brooke at the University of Illinois at Urbana-Champaign for providing
A/California/07/2009 (H1N1) and human alveolar epithelial A549 cells, Joseph Shiloach at
the NIH for providing siat7e cells, Agnieszka Rynda-Apple at Montana State University for
providing MDCK cells, and Albert Parker at Montana State University for assistance with
data analysis and statistics.
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 12
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
REFERENCES
1. Dolan PT, Whitfield ZJ, Andino R. 2018. Mapping the evolutionary poten- 22. Mazutis L, Gilbert J, Ung WL, Weitz DA, Griffiths AD, Heyman JA. 2013. Sin-
tial of RNA viruses. Cell Host Microbe 23:435–446. https://doi.org/10.1016/j gle-cell analysis and sorting using droplet-based microfluidics. Nat Protoc
.chom.2018.03.012. 8:870–891. https://doi.org/10.1038/nprot.2013.046.
2. Petrova VN, Russell CA. 2018. The evolution of seasonal influenza viruses. 23. Xu X, Wang J, Wu L, Guo J, Song Y, Tian T, Wang W, Zhu Z, Yang C. 2020.
Nat Rev Microbiol 16:47–60. https://doi.org/10.1038/nrmicro.2017.118. Microfluidic single-cell omics analysis. Small 16:e1903905. https://doi.org/
3. Brooke CB. 2017. Population diversity and collective interactions during influ- 10.1002/smll.201903905.
enza virus infection. J Virol 91:e01164-17. https://doi.org/10.1128/JVI.01164-17. 24. Prakadan SM, Shalek AK, Weitz DA. 2017. Scaling by shrinking: empower-
4. Fischer AE, Wu SK, Proescher JBG, Rotem A, Chang CB, Zhang H, Tao Y, ing single-cell 'omics' with microfluidic devices. Nat Rev Genet 18:
Mehoke TS, Thielen PM, Kolawole AO, Smith TJ, Wobus CE, Weitz DA, Lin 345–361. https://doi.org/10.1038/nrg.2017.15.
JS, Feldman AB, Wolfe JT. 2015. A high-throughput drop microfluidic sys- 25. Zilionis R, Nainys J, Veres A, Savova V, Zemmour D, Klein AM, Mazutis L.
tem for virus culture and analysis. J Virol Methods 213:111–117. https:// 2017. Single-cell barcoding and sequencing using droplet microfluidics.
doi.org/10.1016/j.jviromet.2014.12.003. Nat Protoc 12:44–73. https://doi.org/10.1038/nprot.2016.154.
5. Loveday EK, Zath GK, Bikos DA, Jay ZJ, Chang CB. 2021. Screening of addi- 26. Holtze C, Rowat AC, Agresti JJ, Hutchison JB, Angile FE, Schmitz CH,
tive formulations enables off-chip drop reverse transcription quantitative Koster S, Duan H, Humphry KJ, Scanga RA, Johnson JS, Pisignano D, Weitz
polymerase chain reaction of single in uenza A virus genomes. Anal DA. 2008. Biocompatible surfactants for water-in-fluorocarbon emulsions.
fl
Chem 93:4365–4373. https://doi.org/10.1021/acs.analchem.0c03455. Lab Chip 8:1632–1639. https://doi.org/10.1039/b806706f.
6. Rotem A, Serohijos AWR, Chang CB, Wolfe JT, Fischer AE, Mehoke TS, Zhang 27. Henderson KS. 2008. Murine norovirus, a recently discovered and highly
prevalent viral agent of mice. Lab Anim (NY) 37:314–320. https://doi.org/
H, Tao Y, Lloyd Ung W, Choi J-M, Rodrigues JV, Kolawole AO, Koehler SA, Wu
10.1038/laban0708-314.
S, Thielen PM, Cui N, Demirev PA, Giacobbi NS, Julian TR, Schwab K, Lin JS,
28. Chu C, Lugovtsev V, Golding H, Betenbaugh M, Shiloach J. 2009. Conversion
Smith TJ, Pipas JM, Wobus CE, Feldman AB, Weitz DA, Shakhnovich EI. 2018. of MDCK cell line to suspension culture by transfecting with human siat7e
Evolution on the biophysical fitness landscape of an RNA virus. Mol Biol Evol gene and its application for influenza virus production. Proc Natl Acad Sci
35:2390–2400. https://doi.org/10.1093/molbev/msy131. U S A 106:14802–14807. https://doi.org/10.1073/pnas.0905912106.
7. Tao Y, Rotem A, Zhang H, Chang CB, Basu A, Kolawole AO, Koehler S, Ren 29. Chu C, Lugovtsev V, Lewis A, Betenbaugh M, Shiloach J. 2010. Production
Y, Lin JS, Pipas JM, Feldman AB, Wobus C, Weitz DA. 2015. Rapid, targeted and antigenic properties of influenza virus from suspension MDCK-siat7e
and culture-free viral infectivity assay in drop-based microfluidics. Lab cells in a bench-scale bioreactor. Vaccine 28:7193–7201. https://doi.org/
Chip 15:3934–3940. https://doi.org/10.1039/C5LC00556F. 10.1016/j.vaccine.2010.08.059.
8. Tao Y, Rotem A, Zhang H, Cockrell SK, Koehler SA, Chang CB, Ung LW, 30. Cristinelli S, Ciuffi A. 2018. The use of single-cell RNA-Seq to understand
Cantalupo PG, Ren Y, Lin JS, Feldman AB, Wobus CE, Pipas JM, Weitz DA. virus–host interactions. Curr Opin Virol 29:39–50. https://doi.org/10.1016/
2015. Artifact-free quantification and sequencing of rare recombinant j.coviro.2018.03.001.
viruses by using drop-based microfluidics. Chembiochem 16:2167–2171. 31. Gérard A, Woolfe A, Mottet G, Reichen M, Castrillon C, Menrath V, Ellouze S,
https://doi.org/10.1002/cbic.201500384. Poitou A, Doineau R, Briseno-Roa L, Canales-Herrerias P, Mary P, Rose G, Ortega
9. Russell AB, Elshina E, Kowalsky JR, te Velthuis AJ, Bloom JD. 2019. Single- C, Delincé M, Essono S, Jia B, Iannascoli B, Richard-Le Goff O, Kumar R, Stewart
cell virus sequencing of influenza infections that trigger innate immunity. SN, Pousse Y, Shen B, Grosselin K, Saudemont B, Sautel-Caillé A, Godina A,
J Virol 93:e00500-19. https://doi.org/10.1128/JVI.00500-19. McNamara S, Eyer K, Millot GA, Baudry J, England P, Nizak C, Jensen A, Griffiths
10. Russell AB, Trapnell C, Bloom JD. 2018. Extreme heterogeneity of influenza vi- AD, Bruhns P, Brenan C. 2020. High-throughput single-cell activity-based screen-
rus infection in single cells. Elife 7:e32303. https://doi.org/10.7554/eLife.32303. ing and sequencing of antibodies using droplet microfluidics. Nat Biotechnol
11. Sun J, Vera JC, Drnevich J, Lin YT, Ke R, Brooke CB. 2020. Single cell hetero- 38:715–721. https://doi.org/10.1038/s41587-020-0466-7.
geneity in influenza A virus gene expression shapes the innate antiviral 32. Liao M, Liu Y, Yuan J, Wen Y, Xu G, Zhao J, Cheng L, Li J, Wang X, Wang F,
response to infection. PLoS Pathog 16:e1008671. https://doi.org/10.1371/ Liu L, Amit I, Zhang S, Zhang Z. 2020. Single-cell landscape of bronchoal-
journal.ppat.1008671. veolar immune cells in patients with COVID-19. Nat Med 26:842–844.
12. Heldt FS, Kupke SY, Dorl S, Reichl U, Frensing T. 2015. Single-cell analysis https://doi.org/10.1038/s41591-020-0901-9.
and stochastic modelling unveil large cell-to-cell variability in influenza A virus 33. Lin J, Jordi C, Son M, Van Phan H, Drayman N, Abasiyanik MF, Vistain L, Tu H-L,
infection. Nat Commun 6:8938. https://doi.org/10.1038/ncomms9938. Tay S. 2019. Ultra-sensitive digital quantification of proteins and mRNA in sin-
13. Kupke SY, Ly L-H, Börno ST, Ruff A, Timmermann B, Vingron M, Haas S, Reichl gle cells. Nat Commun 10:3544. https://doi.org/10.1038/s41467-019-11531-z.
U. 2020. Single-cell analysis uncovers a vast diversity in intracellular viral defec- 34. Sen A, Rothenberg ME, Mukherjee G, Feng N, Kalisky T, Nair N, Johnstone
tive interfering RNA content affecting the large cell-to-cell heterogeneity in IM, Clarke MF, Greenberg HB. 2012. Innate immune response to homolo-
in uenza A virus replication. Viruses 12:71. https://doi.org/10.3390/v12010071. gous rotavirus infection in the small intestinal villous epithelium at sin-
fl
14. Drayman N, Patel P, Vistain L, Tay S. 2019. HSV-1 single-cell analysis gle-cell resolution. Proc Natl Acad Sci U S A 109:20667–20672. https://doi
reveals the activation of anti-viral and developmental programs in dis- .org/10.1073/pnas.1212188109.
tinct sub-populations. Elife 8:e46339. https://doi.org/10.7554/eLife.46339. 35. Timm AC, Warrick JW, Yin J. 2017. Quantitative profiling of innate immune
15. Guo F, Li S, Caglar MU, Mao Z, Liu W, Woodman A, Arnold JJ, Wilke CO, activation by viral infection in single cells. Integr Biol (Camb) 9:782–791.
https://doi.org/10.1039/c7ib00082k.
Huang TJ, Cameron CE. 2017. Single-cell virology: on-chip investigation
36. Zanini F, Pu S-Y, Bekerman E, Einav S, Quake SR. 2018. Single-cell tran-
of viral infection dynamics. Cell Rep 21:1692–1704. https://doi.org/10
scriptional dynamics of flavivirus infection. Elife 7:e32942. https://doi.org/
.1016/j.celrep.2017.10.051. 10.7554/eLife.32942.
16. Timm A, Yin J. 2012. Kinetics of virus production from single cells. Virol- 37. Collins DJ, Neild A, deMello A, Liu AQ, Ai Y. 2015. The Poisson distribution and
ogy 424:11–17. https://doi.org/10.1016/j.virol.2011.12.005. beyond: methods for microfluidic droplet production and single cell encapsu-
17. Zhu Y, Yongky A, Yin J. 2009. Growth of an RNA virus in single cells reveals lation. Lab Chip 15:3439–3459. https://doi.org/10.1039/c5lc00614g.
a broad fitness distribution. Virology 385:39–46. https://doi.org/10.1016/j 38. Loveday EK, Svinti V, Diederich S, Pasick J, Jean F. 2012. Temporal- and
.virol.2008.10.031. strain-specific host microRNAmolecular signatures associated with swine-origin
18. Schulte MB, Andino R. 2014. Single-cell analysis uncovers extensive bio- H1N1 and avian-origin H7N7 influenza A virus infection. J Virol 86:6109–6122.
logical noise in poliovirus replication. J Virol 88:6205–6212. https://doi https://doi.org/10.1128/JVI.06892-11.
.org/10.1128/JVI.03539-13. 39. Köster S, Angilè FE, Duan H, Agresti JJ, Wintner A, Schmitz C, Rowat AC,
19. Akpinar F, Timm A, Yin J. 2016. High-throughput single-cell kinetics of vi- Merten CA, Pisignano D, Griffiths AD, Weitz DA. 2008. Drop-based microfluidic
rus infections in the presence of defective interfering particles. J Virol 90: devices for encapsulation of single cells. Lab Chip 8:1110–1115. https://doi.org/
1599–1612. https://doi.org/10.1128/JVI.02190-15. 10.1039/b802941e.
20. CombeM, Garijo R, Geller R, Cuevas JM, Sanjuán R. 2015. Single-cell analysis of 40. Liu H, Li M, Wang Y, Piper J, Jiang L. 2020. Improving single-cell encapsu-
RNA virus infection identifiesmultiple genetically diverse viral genomes within lation efficiency and reliability through neutral buoyancy of suspension.
single infectious units. Cell Host Microbe 18:424–432. https://doi.org/10.1016/j Micromachines 11:94. https://doi.org/10.3390/mi11010094.
.chom.2015.09.009. 41. Gruner P, Riechers B, Semin B, Lim J, Johnston A, Short K, Baret JC. 2016.
21. Matuła K, Rivello F, Huck WTS. 2020. Single-cell analysis using droplet micro- Controlling molecular transport in minimal emulsions. Nat Commun 7:
fluidics. Adv Biosyst 4:e1900188. https://doi.org/10.1002/adbi.201900188. 10392. https://doi.org/10.1038/ncomms10392.
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 13
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.
Single-Cell Infection of Influenza A Virus in Drops Microbiology Spectrum
42. Chen Y, Wijaya Gani A, Tang SK. 2012. Characterization of sensitivity and 47. R Development Core Team. 2015. R: a language and environment for statisti-
specificity in leaky droplet-based assays. Lab Chip 12:5093–5103. https:// cal computing (version 3.2.2). R Foundation for Statistical Computing, Vienna,
doi.org/10.1039/c2lc40624a. Austria.
43. Etienne G, Vian A, Biocanin M, Deplancke B, Amstad E. 2018. Cross-talk between 48. Bates D, Mächler M, Bolker B, Walker S. 2015. Fitting linear mixed-effects
emulsion drops: how are hydrophilic reagents transported across oil phases? models using lme4. J Stat Soft 67:1–48. https://doi.org/10.18637/jss
Lab Chip 18:3903–3912. https://doi.org/10.1039/c8lc01000e. .v067.i01.
44. Harvey WT, Carabelli AM, Jackson B, Gupta RK, Thomson EC, Harrison EM, 49. Weingartl HM, Berhane Y, Hisanaga T, Neufeld J, Kehler H, Emburry-Hyatt
Ludden C, Reeve R, Rambaut A, Peacock SJ, Robertson DL, COVID-19
C, Hooper-McGreevy K, Kasloff S, Dalman B, Bystrom J, Alexandersen S, Li
Genomics UK (COG-UK) Consortium. 2021. SARS-CoV-2 variants, spike
mutations and immune escape. Nat Rev Microbiol 19:409 424. https:// Y, Pasick J. 2010. Genetic and pathobiologic characterization of pandemic
–
doi.org/10.1038/s41579-021-00573-0. H1N1 2009 influenza viruses from a naturally infected swine herd. J Virol
45. Duffy DC, McDonald JC, Schueller OJA, Whitesides GM. 1998. Rapid proto- 84:2245–2256. https://doi.org/10.1128/JVI.02118-09.
typing of microfluidic systems in poly(dimethylsiloxane). Anal Chem 70: 50. Shu B, Wu KH, Emery S, Villanueva J, Johnson R, Guthrie E, Berman L,
4974–4984. https://doi.org/10.1021/ac980656z. Warnes C, Barnes N, Klimov A, Lindstrom S. 2011. Design and perform-
46. Anna SL, Bontoux N, Stone HA. 2003. Formation of dispersions using “flow fo- ance of the CDC real-time reverse transcriptase PCR swine flu panel for
cusing” in microchannels. Appl Phys Lett 82:364–366. https://doi.org/10.1063/ detection of 2009 A (H1N1) pandemic influenza virus. J Clin Microbiol 49:
1.1537519. 2614–2619. https://doi.org/10.1128/JCM.02636-10.
September/October 2022 Volume 10 Issue 5 10.1128/spectrum.00993-22 14
Downloaded from https://journals.asm.org/journal/spectrum on 10 February 2023 by 153.90.170.56.