RESEARCH ARTICLE
Germ-Free C57BL/6 Mice Have Increased Bone Mass and
Altered Matrix Properties but Not Decreased Bone
Fracture Resistance
Ghazal Vahidi,1 Maya Moody,2 Hope D. Welhaven,2 Leah Davidson,3 Taraneh Rezaee,4 Ramina Behzad,4
Lamya Karim,4 Barbara A. Roggenbeck,5 Seth T. Walk,5 Stephen A. Martin,6 Ronald K. June,1 and
Chelsea M. Heveran1
1Department of Mechanical & Industrial Engineering, Montana State University, Bozeman, Montana, USA
2Department of Chemistry & Biochemistry, Montana State University, Bozeman, Montana, USA
3Department of Chemical and Biological Engineering, University of Idaho, Moscow, Idaho, USA
4Department of Bioengineering, University of Massachusetts, Dartmouth, Massachusetts, USA
5Department of Microbiology & Cell Biology, Montana State University, Bozeman, Montana, USA
6Translational Biomarkers Core Laboratory, Center for American Indian and Rural Health Equity, Montana State University, Bozeman,
Montana, USA
ABSTRACT
The gut microbiome impacts bone mass, which implies a disruption to bone homeostasis. However, it is not yet clear how the gut
microbiome affects the regulation of bone mass and bone quality. We hypothesized that germ-free (GF) mice have increased bone
mass and decreased bone toughness compared with conventionally housed mice. We tested this hypothesis using adult (20- to
21-week-old) C57BL/6J GF and conventionally raised female and male mice (n = 6–10/group). Trabecular microarchitecture and cor-
tical geometry were measured from micro–CT of the femur distal metaphysis and cortical midshaft. Whole-femur strength and esti-
mated material properties were measured using three-point bending and notched fracture toughness. Bone matrix properties were
measured for the cortical femur by quantitative back-scattered electron imaging and nanoindentation, and, for the humerus, by
Raman spectroscopy and fluorescent advanced glycation end product (fAGE) assay. Shifts in cortical tissue metabolism were mea-
sured from the contralateral humerus. GF mice had reduced bone resorption, increased trabecular bonemicroarchitecture, increased
tissue strength and decreased whole-bone strength that was not explained by differences in bone size, increased tissue mineraliza-
tion and fAGEs, and altered collagen structure that did not decrease fracture toughness. We observed several sex differences in GF
mice, most notably for bone tissue metabolism. Male GFmice had a greater signature of amino acid metabolism, and female GFmice
had a greater signature of lipid metabolism, exceeding the metabolic sex differences of the conventional mice. Together, these data
demonstrate that the GF state in C57BL/6J mice alters bone mass and matrix properties but does not decrease bone fracture resis-
tance. © 2023 The Authors. Journal of Bone and Mineral Research published by Wiley Periodicals LLC on behalf of American Society
for Bone and Mineral Research (ASBMR).
KEY WORDS: gut microbiome; bone quality; bone strength; bone tissue metabolism; sex differences
Introduction in host phenotype and disease.[2-6] Moreover, the composition of
microbiome taxa itself is sexually dimorphic.[2,5,7-10] The reper-
T he mammalian gut microbiome is composed of trillions of toire of gut microbial antigens and metabolites can influence
microbial cells and is responsible for the production of a bone mass through their impacts on nutrient transport, system
diverse set of molecules.[1] Evidence suggests that the composi- regulation, and translocation of bacterial products into the sys-
tion of the gut microbiome can drive sex-dependent differences tematic circulation and bones.[8,11-16] The gut microbiome may
This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction
in any medium, provided the original work is properly cited and is not used for commercial purposes.
Received in original form November 14, 2022; revised form May 2, 2023; accepted May 12, 2023.
Address correspondence to: Chelsea M. Heveran, PhD, Department of Mechanical & Industrial Engineering, Montana State University, Bozeman, Montana,
59717, USA. E-mail: chelsea.heveran@montana.edu
Additional Supporting Information may be found in the online version of this article.
Journal of Bone and Mineral Research, Vol. 38, No. 8, August 2023, pp 1154–1174.
DOI: 10.1002/jbmr.4835
© 2023 The Authors. Journal of Bone and Mineral Research published by Wiley Periodicals LLC on behalf of American Society for Bone and Mineral Research
(ASBMR).
n 1154 VAHIDI ET AL. Journal of Bone and Mineral Research
impact osteocytes directly by changing paracrine and endocrine Whether bone material properties in addition to bone mass
signaling from trafficking immune cells.[17] However, whether and microarchitecture are altered in the GF model remains
the microbiome has sexually dimorphic effects on bone cells, unknown. It is not yet understood whether the GF state alters
bone tissue metabolism, and multiscale bone quality is still matrix properties and whether these changes translate into dif-
uncertain; therefore, important interactions between the gut ferences in whole-bone fracture resistance. In this study, we
and the skeleton may be masked. hypothesized that GF mice would have similar or greater bone
Evaluation of hindlimbs from germ-free (GF) mice offers an strength, consistent with their expected increased bone mass,
important insight into the gut microbiome’s role in normal bone but impaired bone matrix properties and fracture toughness
homeostasis. Several studies using this approach reported that compared with conventionally raised controls. We further
female GF C57BL/6 mice had increased bone mass, trabecular hypothesized that the effects of the gut microbiome on the skel-
microstructure, and cortical geometry compared to convention- eton would interact with sex. Because the microbiome has a
ally raised female mice[9,18-21] (Table 1). Though the increased strong effect on cellular energy metabolism in other tissues,[37]
bone mass of GF mice implies the activities of osteoblasts and we also hypothesized that the alterations in bone quality in GF
osteoclasts are dysregulated, the specific impacts of the gut mice would extend to dysregulated bone tissue metabolism.
microbiome on the abundance and activities of each of these
cells are not clear. Because the GF immune system is not fully
developed,[8,18,22-24]
Materials and Methods
osteoclast maturation would be expected
to decrease. Sjorgen and coauthors reported a decrease in oste- Animal model
oclast abundance at the femur of 9-week-old GFmice,[18] while Li
et al. reported no change in osteoclast abundance at the femur All animal procedures were approved by Montana State Univer-
of 12-week-old GF mice.[19] Similarly, Novince et al. reported sity’s Institutional Animal Care and Use Committee. Female and
higher expression of osteoblast-related genes and proteins such male GF C57BL/6J mice (female, n = 6; male, n = 7) were born
as Runx2, Col12a, and osteocalcin in marrow cell cultures from and raised in standard cages inside hermetically sealed isolators
the femur of 12-week-old GF mice,[25] but Yan and coauthors with HEPA-filtered airflow andmaintained on sterile (autoclaved)
reported lower expression of Runx2 in epiphyseal bone from water and food (LabDiet® 5013, Land O’Lakes, developed specif-
13-week-old GF mice[26] (Table 1). Therefore, whether and to ically for autoclaving) ad libitum. Age- and sex-matched conven-
what extent osteoblast and osteoclast abundance and activity tionally raised C57BL/6J mice (female, n = 10; male, n = 10)
in GF mice differ from those of conventional mice remains were also used. Conventional mice were housed in cages of
unclear. three to five mice and fed a standard chow diet ad libitum
Even less is known regarding osteocyte abundance and func- (LabDiet® 5053, Land O’Lakes; Table S2 summarizes minor differ-
tion in the GF state. For example, GF mice lack bacteria-driven ences in the chow diets for GF and conventional animals). Male
vitamin K biosynthesis,[8] which was shown to play an important mice in each group were littermates since mixing males of differ-
role in osteoblast-to-osteocyte transition.[27-31] Therefore, it is ent litters can lead to aggressive behavior and fighting. Female
possible that GF mice have fewer osteocytes. Currently, it is mice were combined from different litters to obtain comparable
unknown whether osteocyte abundance, signaling, or perilacu- sample sizes. All GF and conventional mice were bred in house
nar remodeling is disrupted in GF mice and whether these but ultimately sourced from Jackson Laboratory. Thus, conven-
changes may also be dependent on sex. This particular knowl- tionally raised and GF C57BL/6J mice were not necessarily from
edge gap is important because osteocytes are essential for the same colonies.
indirectly and directly regulating bone mass and bone quality GF status was confirmed using standard cultivation and
over the lifespan[32,33] and often have sexually dimorphic molecular biology techniques.[39] Liquid “bug” traps composed
characteristics.[34-36] of a mixture of drinking water and food were left open to the
If the microbiome is important in bone cell physiology, it is air inside isolators and observed daily for signs of microbial
plausible that at least some of the pathways involved depend growth (i.e., turbidity). Stool samples from mice were monitored
on microbial metabolites used either directly by host cells for prior to and throughout the experiments for signs of growth on
their own metabolism or indirectly as metabolic regulators, rich media under anaerobic and regular atmosphere conditions
which is the case for other nonbone tissues.[37] Thus, there is (Mueller–Hinton broth and agar plates). Bulk DNA was also
a premise for interrogating whether bone tissue metabolism extracted from stool samples (DNeasy PowerSoil Pro DNA isola-
is also regulated by the microbiome. Studying the metabolism tion kit, Qiagen, Hilden, Germany) and used as a template for
of bone tissue provides a snapshot of cellular-level bioenerget- PCR targeting the bacterial 16S rRNA encoding gene (bacteria).
ics, which aids the interpretation of differences in bone remo- GF status was confirmed through lack of growth and amplifica-
deling activity. We recently found that cortical bone metabolic tion by PCR. Alizarin label (30 mg/kg; SIGMA: A3882-1G) was
pathways were sexually dimorphic in 20-week-old C57BL/6J administered sterilely via intraperitoneal injection, 3 days before
mice.[38] These metabolic pathways were mostly attributed to euthanasia. The injection of alizarin labels in GF animals was con-
osteocytes since cortical bone is mostly cellularized by osteo- ducted inside GF isolator cages equipped with glove boxes with
cytes (>90%).[32,33] However, it is likely that metabolites from sterile syringes and needles. The alizarin label was double-
bone marrow still persist in this tissue. We found that female sterile-filtered before injections. Animals were euthanized by iso-
mice had greater levels of lipid metabolism, while male mice flurane overdose and cervical dislocation at age 20–21 weeks.
had higher levels of amino acid metabolism. Stronger bones,
regardless of sex, had higher tryptophan and purine metabo-
[38] Quantitative reverse transcription polymerase chain
lism. Assessing bone tissue metabolism for GF and conven- reaction (qRT-PCR)
tional mice of both sexes provides new insights into the
connections between the microbiome, bone cell health, and Marrow-flushed left tibiae were pulverized in liquid nitrogen and
bone quality. homogenized in Trizol (Life Technologies). Total RNA was
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1155 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 1. Literature Review of Effects of Germ-Free (GF) Status on Hindlimb Bone Quality
Study Mouse Model Bone Measurement Key findings
Sjögren et al., “The gut Female pQCT, MCT, Proximal tibia metaphysis at 7 weeks
microbiota regulates bone C57BL/6J histomorphometry vBMD " 3.2%
mass in mice,” JBMR, 2012.[18] 7–9 weeks old Femur diaphysis at 9 weeks
Ct. Area " 8.9%
Distal femur metaphysis at 7 weeks
BV/TV " 39.7%
Tb.N " 36.%
Tb.Sp # 29.2%
Tb.Th ≈
Distal femur metaphysis at 9 weeks
MAR ≈
M.S/Tb.S " 17.0%
N.Oc/BS # 11.0%
TRAP+ Oc.N (>5 nuclei) # 57.8% (at
8 weeks)
Schwarzer et al., “Lactobacillus Male MCT Femur length # 3.09%
plantarum strain maintains Femur diaphysis
growth of infant mice during BALB/c Ct.Th # 9.6%
chronic undernutrition,” Ct.Ar./Tt.Ar # 4.7%
Science, 2016.[67] 7 weeks old Ct.BMD ≈
Distal femur metaphysis
BV/TV # 24.6%
Li et al., “Sex steroid deficiency– Female MCT Femur metaphysis
associated bone loss is BV/TV " 25%
microbiota dependent and Tb.N " 30%
prevented by probiotics,” JCI, C57BL/6J Tb.Sp # 24%
2016.[9] Tb.Th ≈
20 weeks old Femur diaphysis
Ct.Vol " 6%
Ct.Th " 10%
Li et al., “Parathyroid hormone– Female MCT, histomorphometry Femur metaphysis
dependent bone formation BV/TV ≈
requires butyrate production Tb.Th, Tb.N and Tb.Sp ≈
by intestinal microbiota,” JCI, C57BL/6 Femur diaphysis
2020.[19] Ct.Ar ≈
Ct.Th " 12%
12 weeks old MAR ≈
BFR/BS ≈
N.Oc/BS ≈
N.Ob/BS ≈
Ohlsson et al., “Regulation of Female MCT Femur diaphysis
bone mass by the gut C57BL/6J Ct.Th " 4.9%
microbiota is dependent on 9–10 weeks old
NOD1 and NOD2 signaling,”
Cell. Immun., 2017.[20]
Hahn et al., “The microbiome Female & male MCT Femur epiphysis
mediates subchondral bone (pooled data)
loss and metabolomic C57BL/6 BV/TV " 23%
changes after acute joint 21 weeks old Tb.Th " 11%
trauma,” Osteoarth. Cartil, Tb.N and Tb.Sp ≈
2021.[21]
Novince et al. “Commensal Gut Male MCT, GF vs SPF mice
Microbiota C57BL/6 histomorphometry, Proximal tibia metaphysis
Immunomodulatory Actions 11–12 weeks old cell cultures BV/TV " 19%
in Bone Marrow and Liver Tb.N " 22%
have Catabolic Effects on Tb.Th and Tb.Sp ≈
Skeletal Homeostasis in Distal femur
Trab. B.Ar/T.Ar " 33%
(Continues)
n 1156 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 1. Continued
Study Mouse Model Bone Measurement Key findings
Health,” Scientific Report, MAR " 166%
2017.[25] BFR " 218%
N.Oc/B.Pm ≈
Oc.Ar/Oc # 58%
Oc.Pm/B.Pm # 51
Bone marrow cultures from femur and tibia
Ob. Differentiation Potential "
(Runx2, SP7, Col12a)
Ob. Mineralization " 29%
Yan et al. “Gut microbiota Female & male MCT, GF vs colonized with SPFmicrobiota for 1 month:
induce IGF-1 and promote histomorphometry, (females)
bone formation and growth,” cell cultures Femur metaphysis
PNAS, 2016.[26] BV/TV " 29%
MAR # 20%
CB6F1 BFR/BS # 34%
Epiphyseal bone Runx2 #
GF vs colonized with SPF microbiota for
8 months: (females & males)
Femur length F# 2%, M#
3%
13 weeks old & Femur metaphysis
10 months old BV/TV F≈, M≈
Ct.Porosity F≈, M≈
Ct.Th F≈, M≈
Ec. Ar F≈, M# 20%
Ps. Ar F≈, M# 13%
Note: Arrow directions are in reference to the effect of GF versus conventionally raised mice.
Abbreviations: BFR/BS, trabecular bone formation rate per millimeter bone surface; BV/TV, trabecular bone volume; Ct.Ar cortical area; Ct.Ar/Tt.Ar, cor-
tical area to total cross-sectional area; Ct.Th, cortical thickness; Ct.Vol, cortical volume; Ec, endocortical; F, female; M, male; MAR, mineral apposition rate; N.
Ob/BS, number of osteoblasts per millimeter bone surface; N.Oc/BS, number of osteoclasts per millimeter bone surface; Ps, periosteal; SPF mice, specific-
pathogen-free mice; Tb.N, trabecular number; Tb.Sp, trabecular spacing; Tb.Th, trabecular thickness; TRAP+ Oc.N, number of TRAP+ osteoclasts; vBMD,
volumetric bone mineral density.
isolated using a Qiagen RNeasy Mini Kit (Qiagen) according to 10 objectives. Image analysis was performed using Fiji ImageJ
the manufacturer’s protocol. RNA was reverse transcribed into software (NIH). Total lacunae and empty lacunae were measured
cDNA using a high-capacity cDNA RT kit (Thermo Fisher Scien- from 10 TUNEL-stained sections. The number of osteoclasts
tific, Waltham, MA, USA). qRT-PCR gene expression analyses were and pink-stained lacunae were obtained from TRAP-stained sec-
conducted on an Applied BiosystemsQuantStudio 5 platform using tions. Images taken with the 4 objective were used to deter-
PR1MA qMax Gold SYBR Green Master Mix. Gene expression for mine the total cortical area (TUNEL and TRAP) and endocortical
receptor activator of nuclear factor–kappa B ligand (RANKL), matrix perimeter (TRAP) (Fig. S1). Lacunar number density (numbers/
metalloproteinases (MMP2), matrix metalloproteinase-13 (MMP13), mm2), percentage empty lacunae (numbers of empty lacuna/
matrix metalloproteinase-14 (MMP14), osteoprotegerin (OPG), tar- numbers of all lacunae), osteoclast number density (number of
trate–resistant acid phosphatase (ACP5), and cathepsin K (CTSK) TRAP-positive osteoclasts per endocortical perimeter), and
were determined using the following primer sequences in TRAP-positive lacunae number density (numbers/mm2) were
Table 2. Target gene expressionwas normalized to 18S, and relative calculated.
quantification was determined (ΔΔCt method). The RANKL/OPG Bone marrow adiposity was measured as previously described[38]
ratio was determined using ΔCt calculations. using hematoxylin and eosin (H&E) staining on longitudinally
cut, 5-μm sections of the tibia. Sections were imaged, and
bone marrow adiposity was quantified through manual seg-
Histology mentation. A custom MATLAB code was used to obtain mean
Right tibiae were decalci ed with EDTA disodium salt dihydrate, adipocyte area (mm2), marrow cavity area (mm2), adipocyte
fi
dehydrated in a graded ethanol series, embedded in paraf n, count, and adipocyte number density (number of adipocytes
fi
and serially sliced into 5-μm-thick horizontal cortical diaphysis per marrow cavity area).
sections. Full cortex cross sections from each sample were
stained with terminal deoxynucleotidyl transferase dUTP Nick Serum chemistry analysis
End Labelling (TUNEL) and tartrate–resistant acid phosphatase
(TRAP). Two cortical sections were analyzed per sample for both Serum collected via cardiac puncture at euthanasia was assessed
TUNEL and TRAP stains. Histological slides were imaged using a for biomarkers of bone turnover. Bone formation specific serum
Nikon E-800 microscope (Nikon, Melville, NY, SA) with 4 and level was measured using a Mouse Procollagen 1 N-terminal
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1157 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 2. Primer Sequencing Used for PCR Analysis
Gene Forward primer Reverse primer
Tnfsf11 (RankL) CCAAGATCTCTAACATGACG CACCATCAGCTGAAGATAGT
Mmp2 AACGGTCGGGAATACAGCAG GTAAACAAGGCTTCATGGGG
Mmp13 CGGGAATCCTGAAGAAGTCTACA CTAAGCCAAAGAAAGATTGCATTTC
Mmp14 AGGAGACGGAGGTGATCATCATTG GTCCCATGGCGTCTGAAGA
Tnfrsf11b (OPG) AGAGCAAACCTTCCAGCTGC CTGCTCTGTGGTGAGGTTCG
Acp5 CGTCTCTGCACAGATTGCAT AAGCGCAAACGGTAGTAAGG
Ctsk GAGGGCCAACTCAAGAAGAA GCCGTGGCGTTATACATACA
Rn18s (18 s rRNA) CGAACGTCTGCCCTATCAAC GGCCTCGAAAGAGTCCTGTA
Peptide (P1NP) ELISA kit (MBS703389, My BioSource), and bone an 8-mm span. Femurs were positioned such that the posterior
resorption specific serum level was measured using a Mouse surface was in tension. Load–displacement data were used to
Cross linked C terminal Telopeptide of type 1 collagen (CTX1) calculate estimated whole-bone mechanical properties and tis-
ELISA kit (MBS722404, My BioSource), according to the manufac- sue material properties based on standard flexural equations
turer’s protocols. for the mouse femur, using Imin and C [41]
min values from MCT.
Whole-bone mechanical properties include stiffness (N/mm),
Trabecular microarchitecture and cortical geometry work to fracture (mJ), postyield displacement, maximum load
(N), and peak bending moment (N.mm, referred to as whole-
A high-resolution desktop micro–CT (MCT) imaging system bone strength). Tissue material properties include ultimate stress
(μCT40, Scanco Medical AG) was used to assess the trabecular (MPa, referred to as tissue strength; calculated as the peak bend-
microstructure and cortical geometry of femurs. Left femurs were ing moment divided by section modulus), yield stress (MPa),
harvested and fresh frozen at 20C in phosphate-buffered saline modulus (GPa), and toughness (MJ/m3, area under stress–strain
(PBS)-soaked gauze beforeMCT analysis. Scanswere acquired using curve until first failure). The yield point was identified using a
a 10-μm3 isotropic voxel size, 70 kVP, 114 μA, and 200 ms integra- secant method, where we defined the secant line as 90% of
tion time. Scans were subjected to Gaussian filtration and segmen- the measured stiffness from the linear-elastic portion of the
tation with a value of 0.8 for Gauss sigma (i.e., width of the Gaussian load–displacement curve. The intersection of the secant line
function) and a value of 1 for support (i.e., size of the filter kernel or and the load–displacement curve was the yield point.
the area of the image that is used to compute the convolution) for Notched fracture toughness was evaluated for the right
both trabecular and cortical bone. Image acquisition and analysis femurs, consistent with our description in Welhaven et al.[38] A
protocols adhered to JBMR guidelines.[40] Trabecular microarchitec- custom device (Fig. S2) was used to notch the posterior surface
ture was evaluated at the femoral distal metaphysis in a region of midshaft femurs to a target notch depth of one-third of the
beginning 200 μm superior to the top of the distal growth plate anterior–posterior width.[42] Bone hydration was maintained
and extending 1500 μm proximally. The endocortical region of using PBS. Notched femurs were then tested to failure in three-
the bone was manually contoured to identify the trabeculae. Tra- point bending (1 kN load cell, Instron 5543) at a rate of
beculae were segmented from soft tissue with a 375-mgHA/cm3
0.001 mm/s on a custom fixture with an 8-mm span.[42] Femurs
threshold. Using the Scanco Trabecular BoneMorphometry Evalua- were tested with the posterior surface in tension. Following the
tion Script, the following architectural parameters were measured: test, distal femurs were cleaned of marrow near the fracture sur-
bone volume fraction (BV/TV, %), trabecular bone mineral density face and air-dried overnight. Fracture surfaces were imaged
(BMD,mgHA/cm3), connectivity density (Conn.D, 1/mm3), structural using field emission scanning electron microscopy (FESEM, Zeiss
model index (SMI), ratio of trabecular bone surface to bone volume SUPRA 55VP) in variable pressure mode (VPSE, 20 Pa, 15 kV)
(BS/BV, mm2/mm3), trabecular thickness (Tb.Th, mm), trabecular
 (Fig. S3). A custom MATLAB code was used to assess cortical
number (Tb.N, mm 1), and trabecular separation (Tb.Sp, mm). geometry and the initial notch half angle. Fracture toughness
Cortical geometry was evaluated at the femoral mid-diaphysis values (critical stress intensity factors, Kcmax and Kcinitiation) were
in 50 transverse MCT slices (500 μm) in a region including the calculated using the maximum load and yield load methods[42]
entire outermost edge of the cortex. Cortical bone was seg- (Equation 1). The notch geometry satisfied the thick-wall cylinder
mented with a fixed threshold of 700 mgHA/cm3. The following criteria proposed by Ritchie et al.[42]:
cortical parameters were measured: cortical bone area (Ct.Ar,
mm2), medullary area (Ma.Ar, mm2), total cross-sectional area sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
(bone+medullary area) (Tt.Ar, mm2), cortical tissuemineral den- P
K ¼ F max ð
or PyieldÞ SR0 R0þRi
c b π θinit ð1Þ
sity (Ct.TMD, mgHA/cm3), cortical thickness (Ct.Th, mm), mini- π R4R4o i 2
mum moment of inertia (Imin, mm4), polar moment of inertia
(pMOI, mm4), the maximum radius perpendicular to the Imin where Fb is the geometry constant for thick-walled cylinders,
direction (Cmin, mm), and section modulus (mm3), which was cal- Pmax or Pyield are the maximum load or yield load, respectively,
culated as the ratio of Imin/Cmin. R0 and Ri are themean outer and inner radii, S is the span of load-
ing (8 mm), and θinit is the initial notch half angle.
Whole-bone mechanical and tissue material properties
The left femurs were assessed for flexural material properties Quantitative histomorphometry
using three-point bending (1 kN load cell, Instron 5543, Nor-
wood, MA, USA). The test was performed on PBS-hydrated Poly(methyl) methacrylate (PMMA)-embedded left distal femurs
femurs to failure at a rate of 5 mm/min on a custom fixture with were used for quantitative histomorphometry. Following whole-
n 1158 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
bone mechanical testing, the left femurs were histologically dehy- Microscale assessment of cortical femur tissue modulus
drated in a graded ethanol series (EtOH 70–100%) and embedded
in PMMA. The cortical cross sections of the distal femurs were PMMA-embedded (i.e., dehydrated, PMMA-embedded, and
polished for further analyses. The polishing procedure included polished) left femurs were used for the assessment of bone tis-
600 and 1000 grits of wet silicon carbide papers (Buehler, Lake Bluff, sue modulus. Nanoindentation (KLA Tencor iMicro, Milpitas,
IL, USA), followed by ne polishing with Rayon ne cloths (South CA, USA) was performed on the posterior quadrant of each
fi fi
Bay Technologies, San Clemente, CA, USA) and a series of alumina femur using a Berkovich tip. The target load of 5 mN was
suspensions (9, 5, 3, 1, 0.5, 0.3, and 0.05 μm). Between each step applied with a load function of 30 s load, 60 s hold to dissipate
samples were sonicated with tap water to remove the remaining viscoelastic energy before unloading,[43] and 30 s unload.
alumina particles. An upright confocal laser scanning microscope Each nanoindentation map included three columns of indents
(Leica SP3, Heildelberg GmbH, Mannheim, Germany) was used to spanning the whole cortical thickness (15 μm spacing in x and
visualize the alizarin-fluorochrome-labeled periosteal and endocor- y; Fig. 1A). The mean and SD of the nanoindentation modulus
tical perimeters of the full cortex cross section in the embedded cor- map were calculated for each femur using the Oliver-Phar
[44]
tical femur at the midshaft. Imaging was performed with the approach. The 95th-45th percentiles of the unloading
following parameters: 5 objective, laser wavelength excitation curve were fit with a second-order polynomial. A tangent line
633 nm (emission length 580–645 nm), 600 Hz speed with a to the beginning of this section was used to calculate the stiff-
1024  1024 resolution, and pinhole set at 1 Airy unit. The gain ness (S, the slope of the unloading curve evaluated at the max-
and offset were set to the best label visibility and minimum noise imum load, dP=dh, Fig. 1B). The tip contact area (Ac) was
per sample. ImageJ was used for image processing. Confocal calculated as a function of the contact depth. The tip area was
images were converted to a maximum contrast to visualize reliably calibrated using fused silica (KLA Tencor, Milpitas, CA, USA).
labeled bones and achieve consistent thresholding. Then the The reduced modulus, Er, was calculated from S and Ac
perimeter of alizarin-labeled (L.Pm) bone for endocortical and peri- (Equation 2):
osteal surfaces was measured. Total endocortical and periosteal rffiffiffiffiffi
bone perimeters (Tt.Pm) were also calculated. Percentage mineral- ¼ S π
 E , ð2Þ
izing surface (MS/BS = [L.Pm/Tt.Pm] 100)was reported for endo- r 2 Ac
cortical (Ec.MS/BS) and periosteal surfaces (Ps.MS/BS) for each
group. Animals that did not receive labels were excluded from this 1 ¼ 1υ 2 2
s þ1υt
: ð3Þ
analysis. Er Es Et
Fig. 1. Tissue-scale characterization of cortical femurmid-diaphysis. (A) Tissue-scale modulus was assessed in maps spanning the cortical thickness in the
posterior quadrant. (B) Representative load–displacement curve from a nanoindentation test. (C) Tissue mineralization was evaluated using quantitative
back-scattered electron microscopy. (D) CaPeak and CaWidth were calculated from histograms of each femur cross section. (E) In addition to the use of ref-
erence standards, one control bone sample was evaluated with each imaging session. There was 0.85% variation in the CaPeak for the control bone mea-
sured across imaging sessions.
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1159 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
The nanoindentation modulus (Ei) was then calculated from
Equations (3) and (4), where the subscript s refers to the sample
under study. Et and νt are the known tip modulus (1140 GPa) and
Poisson’s ratio (0.07), respectively. Since the sample’s Poisson
ratio (νs) is unknown, we report the indentation modulus Ei, elim-
inating errors from an assumption for νs (Equation 4):
E
E ¼ s
i  : ð4Þ
1 υ 2
s
Microscale assessment of bone mineralization and
porosity
Following nanoindentation, samples were coated with a thin
layer of carbon for quantitative back-scattered scanning electron
imaging (qBEI, Zeiss Supra 55VP field emission SEM, 20 kV, 60 μm
aperture size, 100 magnification, and 9.1 mm working dis-
tance).[45-47] A custom steel sample holder equipped with
springs that pushes polished embedded bone samples against
a flat steel cover plate was used to ensure both flat sample sur-
faces and consistent working distances (Fig. S4). Images of the
cortical cross sections were collected at 100 magnification Fig. 2. Raman spectroscopy of hydrated humeri. Spectra were collected
(Fig. 1C). Polished carbon and aluminum reference standards from five points on the posterior side of the humeri. The first point (col-
(Electron Microscopy Services) were mounted on the sample ored black) was located where the deltoid tuberosity connects to the pos-
holder and imaged with bone samples with each imaging ses- terior, and other points were located 50 μm apart spanning both
sion. Images were processed by setting the mean gray levels of directions.
the aluminum and carbon calibration standards to 255 and
0, respectively.[48] A custom MATLAB code was used to convert
the BSE images to corresponding calcium concentration, where
each step in the grayscale corresponds to an increase of 0.1385 300–1900 nm Raman spectra range, 30 accumulations for 4-s
weight % calcium. Histograms of BMD distribution with a bin size acquisition time. The spectrometer (800 mm focal length) was
of 1 gray level were generated for each calibrated image. From equipped with a 600-nm grating (300 lines per mm grating),
1
histograms, Ca , the most frequent calcium concentration of which with a 785-nm laser provided a 1.5-cm spectral disper-
Peak
the cortical surface (histogram peak), and Ca , heterogeneity sion. Bones were kept hydrated during the test using a sponge
Width
of the Ca concentration within each sample (full-width at half- bed and tap water. Background fluorescence was removed from
maximum of the histogram,[49] were calculated (Fig. 1D). To all spectra using a 12th-order polynomial fit in the LabSpec 6 soft-
assess the variation between imaging sessions, we imaged one ware (Horiba Jobin Yvon, Edison). Spectra were then analyzed
control bone sample in each of the 12 imaging sessions and cal- using custom MATLAB code. We measured mineral-to-matrix
1 1
culated the coefficient of variation (SD/mean) in the Ca mea- ratio (ν2PO4 [385–495 cm ]/amide ΙΙΙ [1215–1295 cm ]),
Peak
surement of this control bone. We observed 0.85% variability in carbonate-to-phosphate ratio (ν1CO3 [1053–1090 cm1]/ν1PO4
Ca for this control bone between imaging sessions (Fig. 1E). [920–990 cm1], indicative of the extent of carbonate substitu-
Peak
Cortical porosity was assessed for each bone from a 400 tion into the mineral crystal lattice), and crystallinity (full width
1
image of the posterior cortical surface taken in secondary elec- at half maximum of the ν1PO4 peak, FWHM [ν1PO4] ). For these
tron mode (SE2, Zeiss Supra 55VP, 20 kV, 30 μm aperture size, measurements, area ratios were calculated.
9.1 mm working distance). A custom MATLAB code was used The signal-to-noise ratio for amide I subbands was further
to calculate the total porosity (%) and pore number density minimized for each Raman spectrum using a Savitzky–Golay
(number of pores per area of interest, 1/mm2). Pores greater than (S–G) filter. We identified the locations of amide I subbands
150 pixels2 were considered vasculature, and pores smaller than based on the second derivative method and from these loca-
tions’ measured intensities.[50-52]this number were considered lacunae. Amide I subband ratios were
calculated, including 1670/I1610 and I1670/I1640. The following
ranges were used to locate the amide I subband peaks:
Microscale assessment of bone matrix properties 1610 cm1 (1600–1620 cm1), 1640 cm1 (1633–1645 cm1),
1
Tissue composition and collagen properties were assessed using and 1670 cm (1660–1680 cm1). For all Raman measure-
Raman spectroscopy (confocal Raman microscope, Modified ments, spectra were processed individually, and then peak inten-
LabRAM HR Evolution Raman Spectrometer, HORIBA, Japan) on sity ratios were averaged over the five spectra per bone.
hydrated right humeri. Humeri were thawed, cleaned, and
flushed of marrow. For each sample, five spectra were collected Assessment of fluorescent advanced glycation end
from the posterior side, located 50 μm apart (Fig. 2). The location products
of the deltoid tuberosity was used as a marker for the first spec-
trum point (black point in Fig. 2) and other points were spaced After Raman spectroscopy assessment, proximal and distal ends
approximately 50 μm apart. Raman parameters were: 10 dry of the marrow–flushed right humeri were removed such that
objective lens (NA = 0.25), 785 nm edge laser at 100% power, only diaphyseal cortical bone was used in the measurement of
n 1160 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
total fluorescent advanced glycation end products (fAGEs). experimental groups (GF status, sex, and GF status-sex
Quantification and normalization of fAGEs to collagen content interactions).
followed previously published protocols.[53-57] Briefly, the speci-
mens were defatted by three 15-min washes in 200 μL 100% iso- Statistical analysis
propyl ether while being agitated. Specimens were then
lyophilized for 8 h using a FreeZone 2.5 L freeze-dry system We tested whether bone characterization outcomes depended
(Labconco, Kansas City, MO) and hydrolyzed based on dry mass on microbiome status (GF versus conventional), sex (female ver-
in 6 N HCl (10 μL/mg bone) for 20 h at 110C. Hydrosylates were sus male), or their interaction (Minitab, version 20). We used two-
diluted 100 and then centrifuged at 13,000 rpm at 4C to way analysis of covariancemodels (i.e., ANCOVA) with bodymass
remove any debris. Hydrolysates were stored at 80 C in com- as a covariate to test whether body mass differences between
plete darkness until use. Fluorescence was measured at the groups could explain the impacts of GF status, sex, or interac-
360/460 nm excitation/emission for the diluted hydrolysates tion on bone properties. When the covariate effect was insignif-
and quinine standards (stock: 10,000 ng/mL quinine sulfate per icant, the model was run again without it (i.e., ANOVA).
0.1 N H2SO4) using a Synergy HTX Multi-Mode Reader (BioTek, Dependent variables were transformed, if necessary, such that
Winooski, VT). For quanti cation of hydroxyproline, rst a all models satisfied assumptions of residual normality and homo-
fi fi
chloramine-T solution was added to the diluted hydrolysates scedasticity. Significance for themain effects of GF status and sex
and hydroxyproline standards (stock: 2000 μg/mL L-hydroxyproline and the interaction of GF status and sex, was set a priori to
per 0.001 N HCl) and incubated at room temperature for 20 min to p < 0.05. Significant interactions between GF status and sex were
oxidize the hydroxyproline. To quench residual chloramine-T, per- followed up with post hoc tests, and GF versus conventional was
chloric acid (3.15 M) was added and incubated at room temperature compared within each sex (i.e., two comparisons, critical α:
for 5 min. Lastly, a p-dimethylaminobenzaldehyde solution was 0.05/2 = 0.025; Bonferroni correction to maintain family-wise
added and incubated at 60 C for 20 min. All of the samples and type I error). When there was a significant interaction, the
hydroxyproline standards were cooled to room temperature p values of the post hoc comparisons were reported. Nanoinden-
while in complete darkness. Once cooled, absorbance was tation and Raman measurements were averaged per mouse
measured at 570 nm using the same plate reader mentioned such that one mean and one SD for each measure per mouse
earlier for the processed hydrosylate and hydroxyproline were input into the ANOVA models. Percentage differences for
standards. The measured hydroxyproline quantity for each significant main effects were calculated by pooling across both
specimen was used to calculate collagen content,[58] and levels of the other factor (e.g., pooling males and females to cal-
total uorescent AGEs were reported as ng quinine/mg culate the percentage difference between GF and conventional).
fl
collagen. In the case of a significant interaction between GF status and sex,
percentage differences were calculated between GF and con-
ventional mice of each sex. We tested the power of our analyses
using G*Power version 3.1.9.4. Power analyses (t test, differences
Evaluation of cortical bone metabolism between two independentmeans) were conducted for the effect
To investigate themetabolism of cortical bone, humerus-derived of GF versus conventional within each sex. The Cohen’s d effect
metabolites were subjected to liquid chromatography-mass size wasmeasured using themean and SD values for each group.
spectrometry (LC–MS), and global metabolomic pro ling was Then the required sample sizes to achieve a power of 0.8 were
fi
employed for the cortical bone of the left humerus, as previously calculated using the same effect size, α = 0.05, and an allocation
reported.[38] Humerus ends were trimmed and flushed of mar- ratio of 1.
row with PBS to isolate cortical bone and then stored fresh-
frozen at 20C in PBS-soaked gauze. Next, humeri were placed Results
in liquid nitrogen for 2 h and pulverized to optimize metabolite
extraction. Pulverized bone was then precipitated with Effect of gut microbiome on body weight depends on sex
methanol:acetone, vortexed for 1 min, and incubated at 20C GF status and sex had an interactive effect (p = 0.001) on termi-
for 4 min. This process was repeated five times. Samples were nal body weights such that GF females were heavier than con-
then incubated overnight at 20C to promote precipitation. ventional females (+23.4%, 18.6%, p < 0.001), but weights were
The following day, the samples were centrifuged, and superna- not different between GF and conventional males. Femur length
tant was dried down via vacuum concentration. Once dry, sam- was similar across groups (Table 3).
ples were suspended in acetonitrile:water.
Samples were analyzed using LC–MS (Agilent 6538 Q-TOF
 The gut microbiome affects gene expression related to
mass spectrometer) in positive mode (resolution: 20 ppm, bone turnover
adducts: H+, Na+) using a Cogent Diamond Hydride HILIC chro-
matography column, as previously described.[38,59,60] Agilent OPG expression from the marrow-flushed tibia was lower in GFmice
Masshunter Qualitative software, XCMS, MetaboAnalyst, and compared to conventional mice (51.6%, p = 0.032) (Fig. 3). RANKL
MATLAB were used for data analysis. Raw data were log- expression was similar among groups. The RANKL/OPG ratio was
transformed and autoscaled (mean-centered divided by SD per higher in GF mice compared to conventional mice (+127.6%,
variable) prior to analysis. Statistical analyses included hierarchi- p = 0.033).Wealso assessed the expressionof several genes involved
cal cluster analysis (HCA), principal component analysis (PCA), in osteocyte perilacunar remodeling. MMP2 expression decreased
partial least squares-discriminant analysis (PLS-DA), volcano plot with GF status (39.7%, p = 0.044), and the interaction between GF
analysis, t test, and fold-change. MATLABwas utilized to examine status and sex on MMP2 expression was not significant (p = 0.07).
differences in metabolite intensity across experimental groups. MMP13 expression did not differ with GF status or sex. MMP14 was
MetaboAnalyst’s Functional Analysis tool was used to identify expressed more in females compared to males (+64.0%, p = 0.030)
biologically relevant pathways that are dysregulated between but was unchanged with GF status. CTSK expression was lower in
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1161 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 3. Terminal Body Weight and Femur Length
Female Male
Property Conventional (n = 10) GF (n = 6) Conventional (n = 10) GF (n = 7)
Body weight (g) 22.2  2.9 27.4  1.5 30.1  1.8 31.0  1.7
GF x Sex: p = 0.001 #p < 0.001, +23.4%
Femur length (mm) 14.9  0.3 14.9  0.5 15.1  0.3 15.0  0.3
GF: p = 0.64
Sex: p = 0.16
GF x Sex: p = 0.20
Note: All p values correspond to results of omnibus ANOVA test unless specifically indicated by “#” symbol, which indicates a pairwise post hoc test fol-
lowing a significant interaction.
Abbreviation: Data are presented as mean  SD. # = significantly different from conventional mice of same sex.
Fig. 3. Effects of GF status and sex on relative gene expression levels (fold-changes) of OPG, RankL, MMP2, MMP13, MMP14, ACP, CTSK, and on the non-
relative expression level of RankL/OPG ratio. OPG expression was lower in GF mice compared to conventional mice. RankL expression was similar among
groups. MMP2 expression decreased in GF mice. MMP13 expression was similar among groups. MMP14 was expressed more in females compared to
males but was unchangedwith GF status. ACP5 did not differ with sex or GF status. CTSK expression was lower in females thanmales but unchanged with
GF status. The RankL/OPG ratio was higher in GF mice compared to conventional mice. Data are presented as means. Error bars indicate one SD. p values
for significant main effects of GF status or sex are shown above each gene. All p values correspond to results of the omnibus ANOVA test. There were no
interactions between sex and GF.
females than males (+112.8%, p = 0.031) but not changed with GF Osteocyte perilacunar bone resorption, as estimated from
status. ACP5 did not differ with sex or GF status. TRAP-positive lacunae, was decreased in females and GF mice
overall (67%, p = 0.043; 155%, p = 0.021, respectively,
The effects of the gut microbiome on local and global Fig. 4B). In contrast, lacunar number density and percentage
bone turnover depend on sex empty lacunae were not influenced by microbiome status or
sex (Fig. 4C,D).
Sex and GF status had an interactive effect on osteoclast number Serum P1NP was higher in GF mice compared to conventional
density, such that only GF females had reduced osteoclasts per mice (+19.9%, p = 0.03) and in males compared to females
endocortical perimeter (i.e., osteoclast number density) com- (+20.7%, p = 0.008) (Fig. 5A). SerumCTX1 had a significant interac-
pared to conventional mice (75.5%; p = 0.003, Fig. 4A). tion between GF status and sex (p = 0.036) such that CTX1 level
n 1162 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Fig. 4. Effect of GF status and sex on bone resorbing cells. (A) Sex and GF status had an interactive effect on osteoclast number density per perimeter
(number/mm), such that only GF females had reduced osteoclasts per endocortical perimeter compared to their conventional mice. (B) TRAP-stained oste-
ocyte lacunar number density per area (number/mm2) was decreased in females and in GF mice overall. (C) Lacunar number density per area (number/
mm2) and (D) percentage empty lacunae were not influenced by microbiome status or sex. Boxplots represent median value (cross), interquartile range
(box), minimum/maximum (whiskers), and symbols representing all data points. All p values correspond to results of omnibus ANOVA test, unless specif-
ically indicated by “#” symbol, which indicates a pairwise post hoc test following a significant interaction.
Fig. 5. Effect of GF status and sex on serum biomarkers of bone turnover. (A) P1NP, a biomarker of global bone formation, was higher in GF mice com-
pared to conventional mice and in males compared to females. (B) CTX1, a biomarker of global bone resorption, had a significant interaction between GF
status and sex such that CTX1 level was similar among GF and conventional males but lower and more homogeneous in GF females compared with con-
ventional females. (C) CTX1/P1NP ratio was lower for GFmice of both sexes andwas also higher in females compared tomales. Boxplots representmedian
value (cross), interquartile range (box), minimum/maximum (whiskers), and symbols representing all data points. All p values correspond to results of
omnibus ANOVA test, unless specifically indicated by “#” symbol, which indicates a pairwise post hoc test following a significant interaction.
was similar among GF and conventional males but lower andmore (+50.6%, p = 0.005). Females had higher MS/BS values compared
homogeneous in GF females compared with conventional females to males for both periosteal and endocortical surfaces (+29.2%,
(29.7%, p = 0.019) (Fig. 5B). The CTX1/P1NP ratio was lower with p = 0.04 and + 36.1%, p = 0.046, respectively).
GF status in both sexes (26.3%, p = 0.001) and was also higher in
females compared to males (+57.6%, p < 0.001) (Fig. 5C). The gut microbiome does not affect marrow adiposity
Both sex and GF status influenced alizarin mineralizing surface
(MS/BS) at the midshaft femur (Table 4). For the periosteal surface, Bone marrow adiposity analysis revealed differences in adiposity
GF mice had higher MS/BS values compared to conventional mice between mice that differed by sex and GF status (Table S1).
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1163 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 4. Histomorphometric Analysis of Cortical Midshaft Femurs
Female Male
Property Conventional (n = 9) GF (n = 5) Conventional (n = 9) GF (n = 4)
Ps.MS/BS (%) 24.0  10.3 42.5  7.9 22.7  15.5 31.3  12.8
GF: p = 0.005
Sex: p = 0.04
GF x Sex: p = 0.78
Body mass: p = 0.54
Ec.MS/BS (%) 51.8  19.3 55.5  18.9 40.9  18.9 34.4  15.1
GF: p = 0.80
Sex: p = 0.04
GF x Sex: p = 0.50
Body mass: p = 0.48
Note: All p values correspond to results of omnibus ANOVA test.
Abbreviation: Data are presented as mean  SD.
Mean marrow cavity area was lower with GF compared to Cortical thickness increased with female sex (+10.7%,
conventional mice (21%, p = 0.001) and for females compared p < 0.001) but was unchanged with GF status. Ct.TMD was
to males (20%, p = 0.001). Adipocyte counts (25%, p = 0.02) slightly lower with GF status (1.2%, p = 0.003) and female sex
were decreased with GF status. They were also higher in females (+3.8%, p < 0.001). The effect of GF status on cortical geometry
compared to males (+359%, p < 0.001). Consequently, adipo- remained significant even after accounting for the linear rela-
cyte number density (number of adipocytes per marrow area) tionship between geometry and body mass seen in several mea-
was similar between GF and conventional mice and higher in surements (Table S1, Fig. S5A).
females compared to males (+452%, p < 0.001). Adipocyte size Cortical bone porosity, estimated from SEM, showed an inter-
did not differ with GF status or sex. active effect of GF status and sex (p = 0.023) such that total
porosity was decreased for GF males compared to conventional
males (19.6%, p = 0.019) but was unchanged for GF females
The effects of the gut microbiome on trabecular versus conventional females (Fig. 6A). Pore number density was
microstructure and cortical geometry depend on sex not different among groups (Fig. 6B). Lacunar porosity and vas-
cular porosity were also not different among groups (Fig. 6C,D).
GF status increased trabecular bone microstructure, but the
effect was more pronounced for males (Table 5). BV/TV was
higher in GF mice compared to conventional mice (+17.4%,
p = 0.05) and lower in females compared to males (63.1%, The absence of the gut microbiome decreases whole-
p < 0.001). Similarly, Tb.BMD increased with GF status (+9.6%, bone strength but increases tissue strength and modulus
p = 0.05) and was lower in females compared to males
(41.0%, p < 0.001). The structural modulus index showed more GF status decreased whole-bone strength (i.e., peak bending
rodlike trabeculae for females (SMI  3) and more platelike in moment) and maximum load (3%, p = 0.042; 4%,
males (SMI  1.5), but GF status did not affect this measure. GF p = 0.042, respectively). In males, these differences were largely
status and sex had an interactive effect on connectivity density, explained by variance in geometry (Fig. 7A). In females, differ-
such that Conn.D greatly increased for GF males (+79.1%, ences in whole-bone strength were not explained by variance
p < 0.001) but remained unchanged for GF females compared in geometry between GF and conventional groups. Tissue
to their respective conventional mice. GF status and sex also strength (i.e., ultimate stress) was higher in GFmice of both sexes
had an interactive effect on Tb.Th, Tb.N, and Tb.Sp, such that (+13.0%, p < 0.001) compared to conventional mice and was
GF status only affected these properties in males and not also higher in females compared to males (+15.5%, p < 0.001)
females. Tb.Th and Tb.Sp were lower in GF males compared to (Fig. 7C). Similarly, modulus depended on both GF status and
conventional males (13.0%, p = 0.001 and 22.9%, p < 0.001, sex. Specifically, GF mice had higher tissue modulus (+11.7%,
respectively). Tb.N was higher in GF males compared to conven- p = 0.006) compared with conventional mice (Fig. 7D). Females
tional males (+25.6%, p < 0.001). also had higher tissue modulus (+19.2%, p < 0.001) than males.
The effect of GF status on bone cortical geometry was differ- While whole-bone properties depended on body mass
ent between males and females (Table 5). GF status and sex (i.e., larger mice have greater whole-bone strength), the esti-
had an interactive effect on section modulus and Imin such that mated material properties did not (Figs. 7C,D and S5). Complete
GF males had lower Imin and section modulus (27.1%, results from three-point bending are reported in Table S1.
p < 0.001;34.8%, p < 0.001) and GF females had slightly higher The critical stress intensity factor calculated at the maximum
Imin and section modulus (+1.5%, p = 0.021; +9.0%, p = 0.04) load (Kcmax) and at crack growth initiation (Kcinitiation) from
compared to their respective conventional groups (Fig. 7A,B). notched fracture testing did not differ with GF status or sex.
GF status and sex had an interactive effect on pMOI Notably, the effect of GF status on Kcmax was likely underpow-
(p = 0.004) such that GF males had 36% lower pMOI compared ered in females. It is possible that the addition of a few more
to conventional males, whereas GF females had only 4% lower bones (n = 11 per group of females) could reveal an increase
pMOI values compared to conventional females. Ct.Ar decreased in Kcmax for GF females versus conventional females (Fig. 7E,
with GF status in both males and females (9.5%, p < 0.001). Table S1).
n 1164 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 5. Trabecular Microstructure and Cortical Geometry from MCT Analysis
Female Male
Property Conventional (n = 10) GF (n = 6) Conventional (n = 10) GF (n = 7)
Trabecular microarchitecture
BV/TV (%) 6.51  1.10 7.83  2.35 18.12  0.89 20.15  2.69
GF: p = 0.051
Sex: p < 0.001
GF x Sex: p = 0.67
Body mass: p = 0.17
Tb.BMD (mgHA/cm3) 130.82  10.83 142.08  17.19 222.51  23.33 237.73  19.08
GF: p = 0.051
Sex: p < 0.001
GF x Sex: p = 0.76
Body mass: p = 0.28
Conn.D (1/mm3) 33.82  8.71 39.75  18.04 99.88  11.30 178.98  16.56
GF x sex: p < 0.001
Body mass: p = 0.97 #p < 0.001, +79.1%
SMI 3.08  0.25 3.05  0.28 1.54  0.37 1.67  0.30
GF: p = 0.10
Sex: p < 0.001
GF x Sex: p = 0.85
Body mass: p = 0.027
TbTh mm 0.0515  0.0039 0.0559  0.0059 0.0590  0.0045 0.0513  0.0027
GF x Sex: p < 0.001
Body mass: p = 0.26 # p = 0.001, 13.0%
Tb.N (1/mm) 3.02  0.25 3.21  0.17 4.25  0.22 5.35  0.23
GF x Sex: p < 0.001
Body mass: p = 0.56 #p < 0.001, +25.6%
TbSp mm 0.33  0.03 0.31  0.02 0.23  0.01 0.18  0.01
GF x Sex: p < 0.001
Body mass: p = 0.57 #p < 0.001, 22.9%
Cortical microarchitecture
Imin mm4 0.119  0.0127 0.130  0.00036 0.198  0.0260 0.129  0.0106
Sex x GF: p < 0.001
Body mass: p < 0.001 #p = 0.04, +9.0% #p < 0.001, 34.8%
Section modulus mm3 0.196  0.0178 0.199  0.0057 0.280  0.0297 0.204  0.0126
Sex x GF: p < 0.001
Body mass: p < 0.001 #p = 0.021, +1.5% #p < 0.001, 27.1%
pMOI mm4 0.389  0.061 0.397  0.064 0.630  0.093 0.411  0.033
Sex x GF: p = 0.004
Body mass: p < 0.001 #p < 0.001, 36.5%
Ct Area mm2 0.853  0.074 0.834  0.016 0.971  0.078 0.818  0.044
GF: p < 0.001
Sex: p = 0.07
Sex x GF: p = 0.06
Body mass: p < 0.001
CtTh mm 0.197  0.011 0.195  0.018 0.179  0.009 0.175  0.008
GF: p = 0.27
Sex: p < 0.001
GF x sex: p = 0.74
Body mass: p = 0.049
CtTMD mgHAcm3 1244.00  10.50 1229.60  20.0 1198.80  9.76 1185.40  1.93
GF: p = 0.003
Sex: p < 0.001
GF x Sex: p = 0.91
Body mass: p = 0.78
Note: All p values correspond to results of omnibus ANOVA test unless specifically indicated by “#” symbol, which indicates a pairwise post hoc test fol-
lowing a significant interaction.
Abbreviation: Data are presented as mean  SD. # = significantly different from conventional mice of same sex. In the case of a significant interaction,
main effects are not reported.
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1165 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Fig. 6. Cortical porosity assessments. (A) Total porosity was decreased for GF males compared to conventional males but was unchanged in females.
(B) Lacunar porosity, (C) vascular porosity, and (D) pore number density were unchanged with sex and GF status. Boxplots represent median value (cross),
interquartile range (box), minimum/maximum (whiskers), and symbols representing all data points. All p values correspond to results of omnibus ANOVA
test, unless specifically indicated by “#” symbol, which indicates a pairwise post hoc test following a significant interaction.
Fig. 7. Whole-bone and tissue properties of femurs for GF versus conventional mice from flexural testing. (A) The linear relationship betweenwhole-bone
strength (peak bending moment) and section modulus was altered with GF status in female mice but not males. (B) Imin is increased for GF females and
decreased for GF males compared with conventional mice of the same sex. (C) Tissue strength (i.e., ultimate stress) and (D) modulus were greater for GF
comparedwith conventional mice of both sexes. (E) Kcmax from notched fracture testing of contralateral femur did not differ with GF status or sex but may
be underpowered for females (GF females versus conventional females, p = 0.1). Boxplots represent median (cross), interquartile range (box), minimum/
maximum (whiskers), and symbols representing all data points. All p values correspond to results of omnibus ANOVA test, unless specifically indicated by
“#” symbol, which indicates a pairwise post hoc test following a significant interaction.
n 1166 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Fig. 8. Effect of GF status and sex on tissue scale composition and collagen structure. (A) Mineral-to-matrix ratio was higher in GF mice compared to con-
ventional mice for both sexes. (B) Carbonate to phosphate ratio was not affected by GF status or sex. (C) I1670/I1640 ratio and (D) I1670/I1610 ratio were
increased in GF mice. Boxplots represent median value (cross), interquartile range (box), minimum/maximum (whiskers), and symbols representing all
data points. All p values correspond to results of omnibus ANOVA test.
The absence of the gut microbiome increases tissue Alterations in whole-bone quality with microbiome status
mineralization and impacts collagen structure and AGE are multifactorial
accumulation The correlations between whole-bone mechanical properties
The mineral-to-matrix ratio (ν2PO4/Amide ΙΙΙ) from Raman spec- (whole-bone strength) and estimated tissue material properties
troscopy was higher in GF mice compared to conventional mice (tissue strength, modulus, and fracture toughness) with tissuemin-
for both sexes (+6%, p = 0.024) (Fig. 8A). Mineral maturity, as indi- eralization (CaPeak), collagen structure, cortical porosity, and bone
cated by the ratio of carbonate to phosphate (carbonate substitu- turnover parameters, including Ps.MS/BS (alizarin mineralizing sur-
tion, ν1CO3/ν1PO4) (Fig. 8B), and crystallinity (Table S1) were not face) and osteoclast number density, were tested using Spearman’s
affected by GF status or sex. There were no main effects of sex or correlation (95% CI). We found that CaPeak from qBEI was positively
sex-GF status interactions on Raman measurements of bone com- correlated with tissue strength (i.e., ultimate stress, Spearman’s
position. CaPeak values from qBEI were slightly higher (+3.0%, ρ = 0.49, p = 0.006) and modulus (ρ = 0.47, p = 0.009). However,
p = 0.018) for GF mice compared to conventional mice but were CaPeak was not correlated with whole-bone strength (i.e., peak
not affected by sex (Fig. 9A). CaWidth values were similar among bending moment, ρ = 0.09, p = 0.62). The subband ratio I1670/
all groups (Table S1). GF status increased the mean nanoindenta- I1640 from Raman spectroscopy had a moderate, positive correla-
tion modulus only for males (+8.4%, p = 0.023, Figure 9B). The tion with tissue strength (ρ = 0.45, p = 0.01) and modulus (ρ = 0.
SD of Ei was unaffected by GF status or sex (Table S1). 54, p = 0.002) but was not correlated with whole-bone strength
GF status also affected several properties related to collagen. (ρ = 0.10, p = 0.5). Cortical porosity from SEM had a moderate,
From Raman spectroscopy, GF status was observed to impact negative correlation with both tissue strength (ρ = 0.38,
amide I subpeak intensity ratios. Disruption in the helical status p = 0.03) and modulus (ρ = 0.45, p = 0.01), but these correla-
of the collagen can indicate a transition from an ordered triple tions were more evident for males (ρ = 0.57, p = 0.01 for tissue
helical structure to less-ordered forms of structures in colla- strength, ρ = 0.56, p = 0.02 for modulus) and not so much for
gen.[50,61] The amide I subband ratio I1670/I1640 was slightly higher females (ρ = 0.30, p = 0.31 for strength, ρ = 0.23, p = 0.42 for
in GF mice (+3.5%, p = 0.050), while I1670/I1610 increased more in modulus). Cortical porosity was not correlated with whole-bone
GFmice (+8.3%, p = 0.011) (Fig. 8C,D). There was no effect of sex strength (ρ = 0.19, p = 0.29); however, when tested only in
or interaction between sex andGF status on these or other Raman females, a weak correlation (ρ = 0.30, p = 0.28) between cortical
measurements. Cortical fAGE content in the humerus was higher porosity andwhole-bone strengthwas evident.We foundno signif-
(+103%, p = 0.001) in GF bones compared to conventional spec- icant correlations between CaPeak and cortical porosity with bone
imens (Table S1). Sex did not affect fAGEs, and there was no inter- fracture toughness (i.e., the critical stress intensity factor evaluated
action between GF status and sex on fAGE content. at the maximum load, Kcmax).
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1167 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Fig. 9. Effect of GF status and sex on tissue scale material properties. (A) CaPeak from qBEI was slightly higher in GF mice but was not affected by sex. (B)
Nanoindentation modulus (Ei) was increased in GF males and unchanged in GF females compared to their respective conventional groups. Boxplots rep-
resentmedian value (cross), interquartile range (box), minimum/maximum (whiskers), and symbols representing all data points. All p values correspond to
results of omnibus ANOVA test, unless specifically indicated by “#” symbol, which indicates a pairwise post hoc test following a significant interaction.
We found that local bone formation at the periosteal surface (Fig. 10B), GF males versus conventional males (Fig. 10C), and
(Ps.MS/BS) was positively correlated with estimated bone tissue GF females versus conventional females (Fig. 10D).
material properties including tissue strength (ρ = 0.57, Volcano plot analysis was utilized to identify subpopulations of
p = 0.002) and modulus (ρ = 0.36, p = 0.07). Ps.MS/BS was not metabolite features that were different between GF and conven-
correlated with whole-bone strength (i.e., peak bending tional for mice of the same sex. In total, 152 features were statisti-
moment, ρ = 0.01, p = 0.93). When tested only in females, Ps. cally significant and had higher concentrations in GF females
MS/BS was positively correlated (ρ = 0.57, p = 0.03) with compared to conventional females, whereas 22metabolite features
whole-bone strength. Endocortical surface bone formation was were statistically significant and had higher concentrations in con-
not correlated (ρ < 0.3, p > 0.05) with whole-bone mechanical ventional females compared to GF females. (Fig. 10E). Twenty-one
or tissue material properties. Osteoclast number density from metabolite features were statistically significant and had higher
TRAP staining was not correlated with tissue strength (ρ = 0.26, concentrations in GF males compared to conventional males,
p = 0.15) or modulus (ρ = 0.25, p = 0.16). Osteoclast number whereas 188were statistically significant andhad higher concentra-
density had a weak negative correlation with whole-bone tions in conventional males compared to GF males (Fig. 10F).
strength (ρ = 0.31, p = 0.09), but this correlation was mainly Heatmap analysis identified clusters of metabolite features
evident for females (ρ = 0.51, p = 0.06) and not so much in specific to the four groups of male and female GF and conven-
males (ρ = 0.15, p = 0.57). We found no correlations between tional mice (Fig. 10G, Table S3). Pathways associated with the
Ps.MS/BS and osteoclast number density with bone fracture selected clusters from heatmaps and with the metabolite fea-
toughness (i.e., critical stress intensity factor Kcmax) for pooled tures from the volcano plot were identified for each group. A
males and females. However, for females, we observed that bone shared metabolic theme among all females, GF and conven-
fracture toughness positively correlated with Ps.MS/BS (ρ = 0.66, tional, was increased levels of glycosaminoglycan degradation.
p = 0.02) and negatively correlatedwith osteoclast number density The most significant metabolite feature for GF females was
(ρ = 0.43, p = 0.1). These independent variables (i.e., collagen increased lipid metabolism (sphingolipid metabolism and ara-
structure, cortical porosity, and bone turnover parameters) were chidonic acid metabolism), whereas for conventional females,
not correlated or weakly correlated with each other (ρ < 0.3, significant metabolite features corresponded to increased levels
p > 0.05), with the exception of osteoclast number density and cor- of glycosylphosphatidylinositol (GPI)-anchor biosynthesis and
tical porosity, which displayed a negative correlation (ρ = 0.46, amino acid metabolism (cysteine, methionine). The shared met-
p = 0.009). abolic theme among all males, GF and conventional, was
increased levels of amino acid metabolism (alanine, aspartate,
glutamate, arginine, histidine, cysteine, methionine). Metabolite
Microbiome and sex each distinctly influence the cortical features increased in GF males corresponded to increased levels
bone metabolome of porphyrin metabolism, whereas features increased in conven-
tional males corresponded to increased levels of purine metabo-
A total of 2,129 metabolite features were detected across all lism, terpenoid backbone biosynthesis, and the pentose
humerus cortical bone samples (Table S3). We used PLS-DA to phosphate pathway.
compare the effects of GF status (GF versus conventional), sex
within treatment (GF males versus GF females, conventional
males versus conventional females), and the effect of GF status Discussion
within sex (GF females versus conventional females, GF males
versus conventional males). PLS-DA analysis of all four groups The purpose of this study was to test the hypothesis that GF
displayed minimal overlap, suggesting the metabolomes of all C57BL/6J mice have increased bone mass and decreased bone
four groups were distinct (Fig. 10A). Distinct separations were fracture resistance compared to conventional mice. To test this
observed between male and female metabolites for GF mice hypothesis, we investigated the impact of GF status on bone
n 1168 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Fig. 10. Global metabolomic profiles of humerus-derived cortical bone vary by sex and microbiome, as identified by multiple analyses. From supervised
PLS-DA analysis, (A) metabolites of all four groups showed a clear separation. (B) GF males and GF females, (C) GF males and conventional males, and
(D) GF females and conventional females all had distinct metabolomes. From volcano plot analysis (E) metabolite features detected for GF females were
significantly different from those detected for conventional females, and, similarly, (F) metabolite features were differently regulated between GF males
and conventional males. (G) Median-intensity heatmap analysis displayed clusters of metabolites that were differentially regulated between all groups.
C1–C5 = clusters 1–5.
tissue metabolism, bone turnover, bone matrix properties, The osteocyte regulates bone remodeling,[32,33] and prior
microarchitecture, and whole-bone fracture resistance. Our work suggests that the osteoblast to osteocyte transition may
results demonstrate that GF mice have high bone mass and be decreased in GF mice through disruptions in the immune sys-
altered bone matrix compared to conventional mice, but not tem and bacteria-derived vitamin K2 biosynthesis.[29,69] There-
decreased fracture resistance (i.e., similar or higher strength fore, we investigated the influences of GF status and sex on
and toughness). Our results also reveal important sex differences osteocyte abundance, gene expression related to osteocyte con-
in the impact of GF on bone properties (Table 6). trol of osteoclast and osteoblast differentiation and lacunar-
Our results suggest the gutmicrobiomeplays an important but canalicular system turnover, and osteocyte perilacunar bone
different role in bone formation and resorption in female and resorption. We found that GF status did not alter lacunar number
male mice (Table 6). For both sexes, GF status increased cortical density or percentage of empty lacunae for either females or
bone formation at the femur diaphysis. GF females had reduced males. Being GF increased RANKL/OPG ratio by downregulating
osteoclast density in cortical bone, but GF males did not. These OPG expression in both males and females. The RANKL-OPG sig-
cortical femur-specific data alignedwith global serum biomarkers naling system regulates osteoclastogenesis in the marrow[70]
of bone formation and resorption. We observed no change in adi- and the downregulation of OPG promotes osteoclastogenesis
pocyte density with GF status, suggesting that mesenchymal and osteoclastic activity.[71] Osteocyte perilacunar bone resorp-
stem cell differentiation toward adipocyte-lineage cells may not tion, as estimated from TRAP-positive lacunae, was lower in GF
be influenced by GF status. GF mice have an immature immune mice. However, GF status did not impact most measurements
system,[18,24] which would be expected to influence precursors of gene expression related to lacunar-canalicular system remo-
available for differentiation to osteoclasts. The presence of sexual deling. These data suggest efforts by osteocytes in the context
dimorphism in immunological responses to different diseases of the GF model to decrease bone mass and participate in
was previously reported, with greater proinflammatory cytokine lacunar-canalicular bone remodeling but failure to achieve it
responses and T-cell proliferation in female humans and mice reduced osteoblast activity or increased osteoclast activity.
compared to their male counterparts.[62,63] Females also have We observed that GF males and females had decreased
enhanced innate and adaptive immune responses to inflamma- whole-bone strength (i.e., peak bending moment), increased
tion or bacteria-driven diseases.[64,65] Similarly, evidence supports bone tissue strength (i.e., ultimate stress) and modulus, and
sex differences in osteoclast differentiation and precursor popula- unchanged bone fracture toughness. Notably, our analysis to
tion, although specific results are contradictory.[65-68] Some stud- test the effect of GF versus conventionally housed mice on criti-
ies reported that in vitro osteoclastogenesis occurs faster in cal stress intensity measured at maximum load (Kcmax) was
osteoclast precursor derived from female mouse cells compared underpowered in females, and it is possible that the addition of
to male cells in the absence of pathogens,[66,68] while others a few more bones (n = 11 per group of females) could reveal
reported bacterial-induced osteoclastogenesis in vitro is faster in an increase in Kcmax for GF females. GF mice had several disrup-
male osteoclast precursor cells compared to females.[67] The sex tions to bone matrix, including increased cortical tissue mineral-
differences in the decline of osteoclast number in our study imply ization from qBEI, increased fAGE content, and altered collagen
a likely difference in either the immune systems of male and structure, as indicated by increased I1670/I1640 and I1670/I1610
female GF mice or a sexual dimorphism in the resilience of osteo- ratios from Raman spectroscopy. However, we note that while
clast differentiation on the immune system. fracture toughness was shown in prior studies of human cortical
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1169 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Table 6. Key Findings for Influence of GF Status and Sex on Bone Multiscale Properties
No interaction Significant interaction
between GF and sex between GF and sex
GF female versus GF male versus
GF versus Female conventional conventional
Measure conventional versus male female male
Bone turnover
Midshaft femur Ps.MS/BS (%) " 50.6%** " 29.2%* NS NS
Ec.MS/BS (%) NS " 36.1%* NS NS
Serum biomarkers P1NP (ng/ml) " 19.9%* # 20.7%** NS NS
CTX1 (ng/ml) - - # 29.7%* NS
CTX1/P1NP # 26.3%** " 57.6%*** NS NS
Proximal tibia TRAP+ Lac. N. density # 67%* # 155%* NS NS
(#/mm2)
Histology Oc. N. density (#/mm) - - # 75%* NS
Flushed tibia-PCR MMP2 # 38.9%* NS NS NS
MMP14 NS " 65.2%* NS NS
OPG # 50.5%* NS NS NS
RankL/OPG " 127.6%* NS NS NS
CTSK NS " 97.1%* NS NS
Bone microstructure and geometry
Cancellous: distal Femur BV/TV (%) " 17.4%* # 63.1%*** NS NS
metaphysis Conn.D (1/mm3) - - NS " 79.1%***
Tb.Th (mm) - - NS # 13.0%**
Cortical: midshaft Femur Ct.Ar (mm2) # 9.5%*** NS NS NS
I 4
min (mm ) - - " 9.0%* # 34.8%***
Ct.TMD (mgHA/cm3) # 1.2%** " 3.8%*** NS NS
Whole-bone mechanical and tissue material properties
Femur Whole-bone strength (N. # 4%* NS NS NS
mm)
Modulus (GPa) " 11.7%* " 19.2%*** NS NS
Tissue strength (MPa) " 13%*** " 15.5%*** NS NS
Yield strength (MPa) NS NS NS NS
Toughness (3 PB) (MJ/m3) NS NS NS NS
Kcmax and Kcinitiation (MPa. NS NS NS NS
√m)
Tissue-scale mineralization and cortical porosity
Midshaft femur Ei (GPa) - - NS " 8.4%*
Stdev. Ei (GPa) NS NS NS NS
CaPeak (wt%) " 3.0%* NS NS NS
CaWidth (wt%) NS NS NS NS
Cortical porosity (%) - - NS # 19.6%*
Tissue composition and matrix properties
Humerus Mineral/matrix " 6.0%* NS NS NS
Car/Phos NS NS NS NS
Crystallinity NS NS NS NS
I1670/I1610 " 8.3%* NS NS NS
I1670/I1640 " 3.5%* NS NS NS
fAGE (ng quinine/mg " 100%* NS NS NS
collagen)
Bone metabolism
Proximal tibia Marrow cavity area (mm2) # 21%** # 20%** NS NS
Histology Adipocyte count # 25%* " 359%*** NS NS
Humerus metabolomics " Lipid metabolism in GF females*.
" GPI-anchor biosynthesis in conventional females*.
" Porphyrin metabolism in GF males*.
" Amino acid metabolism in conventional males*.
Note: NS indicates p > 0.05, * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001. When an interaction exists, themain effects of GF and
sex are not reported.
n 1170 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
bone to negatively correlate with amide I subband intensity metabolites in energy metabolism (i.e., upregulated porphyrin
ratios I1670/I
[61]
1640 and I1670/I1610, suggesting disrupted collagen metabolism in GF males and upregulated purine metabolism in
structure,[50,61] we do not witness this same relationship with conventional males). Adipocyte number density was not
GF mice. increased in GFmice, suggesting that the increased levels of lipid
It is currently unclear whether vitamin K plays a fundamental metabolism are not a consequence of increased differentiation
role in the strength and fracture toughness of bone tissue. The of mesenchymal stem cells to adipocytes. GF females also had
absent gut microbiome must necessarily eliminate the produc- increased levels of arachidonic acid metabolites, which are
tion of gut microbe-derived forms of vitamin K (menaquinones reported to be inhibitors of osteoclastic function, compared to
MK5-MK13, otherwise known as vitamin K ).[69]2 Vitamin K2 conventional females.[87] Together, these findings suggest that
directly impacts bone mineralization through carboxylation of osteoclast population and bone resorption activity in GF females
osteocalcin, the most abundant noncollagenous protein.[27,72-75] could be impacted by altered dynamics of lipid metabolism.
75] Some reports also indicate that changes to osteocalcin min- Conversely, conventional females had increased levels of cyste-
eralization can deleteriously affect fracture toughness.[27,72,76,77] ine and its precursor methionine compared to GF females.[88]
We did not measure the vitamin K2 content in the study mice, Cysteine is a key component of cathepsin k protease that is pre-
but our data do not clearly support the idea that vitamin K2 has dominantly expressed in osteoclasts and is essential to bone
a large effect on bone fracture resistance. resorption activity.[89] Conventional females had the highest
We sought to investigate whether the impacts of GF status on osteoclast population and global resorption activity among all
estimated whole-bone mechanical properties and tissue mate- groups, both of which drastically decreased with GF status. Males
rial properties were driven by cortical porosity or tissue mineral- had increased levels of energy and amino acid metabolisms
ization. These independent variables were chosen because it is compared to females, with GF males having the highest levels
well established that bone elastic modulus and strength corre- of porphyrin metabolism and conventional males having the
late with bone cortical porosity[78-82] and tissue mineraliza- highest levels of purine metabolism. This finding is consistent
tion.[80,82-86] We found that whole-bone strength (i.e., peak with GF males having the highest bone formation (P1NP and
bending moment) was not correlated with cortical porosity or BV/TV) in all groups, based on our prior work.[38] We previously
tissue mineralization from qBEI. However, both tissue strength reported that in conventional mice, bone cells from males and
(i.e., ultimate stress) and modulus had a weak to moderate posi- females rely on different metabolic pathways to meet their
tive correlation with tissue mineralization and a negative correla- energy demands. While cells from male mice used amino acid
tion with cortical porosity. These factors were also not metabolism, cells from females predominantly utilized lipid
intercorrelated (ρ < 0.3). Therefore, alterations in bone tissue metabolism.[38] It appears that in GF mice, these differences
strength and modulus with GF state are likely the result of multi- between male and female cortical bone metabolome become
ple contributing factors including at least tissue mineralization even more pronounced. GF females and males both build more
and cortical porosity. bone compared to conventional mice, but this evidence sug-
Because GF status increased local bone formation (just Ps.MS/ gests that they may engage in different energy metabolism to
BS and not Ec.MS/BS) and decreased osteoclast number density, do so. These results demonstrate that GF status affects the bioen-
we also asked whether the changes to whole-bone mechanical ergetics of bone cells and that this impact is different in males
and tissue material properties were the result of decreased bone and females.
turnover. We found that whole-bone strength (i.e., peak bending A strength of our study is in its evaluation of sex differences in
moment) did not correlate with local bone formation (Ps.MS/BS) multiscale bone quality for skeletally mature mice. Through this
or with osteoclast number density in pooled male and female work, we have accumulated, to our knowledge, the largest data-
data. However, in females only, whole-bone strength had amod- set of sex differences in bone quality among conventional
erate positive correlation with Ps.MS/BS and a moderate nega- C57BL/6mice currently available in the literature. Key differences
tive correlation with osteoclast number density. Bone tissue pertaining to estimated whole-bone mechanical and tissue
strength (i.e., ultimate stress) and modulus for both sexes had a material properties and microarchitecture include higher
weak to moderate positive correlation with Ps.MS/BS but not whole-bone strength (peak bending moment), higher tissue
with osteoclast number density. These results demonstrate that strength (ultimate stress) andmodulus, smaller trabecular micro-
the impact of the gut microbiome on bone quality is partially, structure, and smaller cortical geometry in females compared to
but not fully, determined by changes to bone turnover. Impor- males. Sex differences related to bone turnover include
tantly, the lack of microbiome can cause several other important increased bone mineralizing surface, higher bone turnover,
developmental differences in the skeleton compared to conven- decreased osteocyte perilacunar bone resorption, higher osteo-
tional mice. These differences include increased bone mass in clast number density, increased cathepsin K and MMP14 expres-
growing C57BL/6 mice,[18] shorter femurs in 7-week-old male sion, and higher adipocyte number for females. Meanwhile,
BALB/c mice with smaller and thinner cortical area and lower tissue-scale mineralization, collagen structure, and fAGE content
bone volume fraction,[67] and increased cortical thickness in 10- were similar for conventional females and males. We anticipate
to 12-week-old female C57BL/6 mice.[19,20] that these reference data will be broadly useful in interpreting
Since GF status showed sex differences for some features of sex differences in bone quality occurring in disease models and
bone quality as well as in the abundance and activity of bone other interventions.
cells, we studied the sex differences in how GF status affected Our study has several important limitations. First, GF mice
bone cell metabolism. We evaluated the metabolism of cortical have developmental differences with conventionally raised
bone, which is predominantly populated by osteocytes. We mice,[28,90] which likely have a confounding role in the effects
found that, compared to conventional mice of the same sex, of lack of microbiome on the skeleton. Second, it was necessary
female GF mice had increased lipid metabolism (highest of all to characterize bone at multiple skeletal locations due to differ-
groups) and male GF mice had differentially regulated ent sample preparation requirements for each technique,
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1171 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
though skeletal site differences are likely to impact the reported expressed in this material are those of the authors and do not
results. A limitation in assessing bone tissue metabolism is that necessarily reflect the views of the funding organizations.
we cannot strictly discriminate which cells are responsible for
the observed metabolism differences. Since osteocytes are the Author Contributions
most common (>90%) cells in cortical bone,[32,33] it is very likely
that their metabolism is included in these metabolic shifts. How- Ghazal Vahidi: Data curation; formal analysis; visualization;
ever, it is possible that other cells present in the bone tissue writing – original draft; writing – review and editing; conceptual-
(e.g., osteoblast, osteoblast, lining cells, possible remaining adi- ization; methodology; investigation.Maya Moody: Formal anal-
pose cells) may contribute to the observed metabolomic differ- ysis; investigation; methodology; writing – review and editing;
ences between the groups as well. Another limitation of this writing – original draft. Hope D. Welhaven: Formal analysis;
study is that GF and conventional mice did not receive fully iden- investigation; methodology; writing – review and editing;
tical diets, although they had identical vitamin K content and a writing – original draft. Leah Davidson: Investigation;
nearly identical percentage of calories from protein, fat, and car- writing – review and editing. Taraneh Rezaee: Investigation; for-
bohydrates (Table S2). We did not measure vitamin K content in mal analysis; methodology. Ramina Behzad: Investigation; for-
the study animals, which limited our ability to test the relation- mal analysis. Lamya Karim: Methodology; formal analysis;
ship between vitamin K and changes to bone quality in the writing – review and editing; supervision. Barbara
absence of the gut microbiome. Most importantly, GF models A. Roggenbeck: Investigation; methodology. Seth T. Walk:
are not directly translatable to humans. Nonetheless, GF models Conceptualization; resources; writing – review and editing; fund-
provide unique insights about the origin of the microbiome ing acquisition; methodology. Stephan A. Martin: Formal analy-
impacts on the bone quality that are not accessible from other sis; methodology; supervision; writing – review and editing.
models. In this work, we did not investigate specific contribu- Ronald K. June: Methodology; formal analysis; supervision;
tions of the gut microbiome to the regulation of bone matrix resources; writing – review and editing; funding acquisition.
properties. Our findings motivate additional investigation in Chelsea M. Heveran: Conceptualization; writing – original draft;
this area. writing – review and editing; methodology; resources; supervi-
We conclude that the absence of the gut microbiome in sion; funding acquisition; data curation; project administration.
female and male 20- to 21-week-old C57BL/6 mice not only
increases bone mass but also impacts bone matrix properties,
including collagen structure and bone mineralization. Notably, Peer Review
the absence of the gut microbiome does not decrease bone frac-
ture resistance for GFmice (i.e., higher tissue strength and similar The peer review history for this article is available at https://www.
fracture toughness to conventional mice). Many repercussions of webofscience.com/api/gateway/wos/peer-review/10.1002/
an absent gut microbiome on bone, such as the activities and jbmr.4835.
abundance of remodeling bone cells, are sex-dependent. These
alterations extend to the level of bone tissue metabolism as we Data Availability Statement
demonstrated that GF status exacerbated sex differences that
are seen in conventionally raised mice. This study advances the The data that support the findings of this study are available
fundamental understanding of the gut microbiome and sex from the corresponding author upon reasonable request. Source
interactions and their effects on the development and mainte- mass spectrometry files are available on theMetabolomicsWork-
nance of bone mass and matrix quality. bench repository under Study ID: ST002342.
Disclosures
Acknowledgments
The authors have no conflicts of interest to disclose. Dr. June
owns stock in Beartooth Biotech, which was not involved in this
We gratefully acknowledge Mark McAlpine for his assistance in study.
germ-free mouse handling. LC–MS analyses were performed
with help from Dr. Don Smith, Dr. Katie Steward, Jesse Thomas,
and the Montana State University Proteomics, Metabolomics References
and Mass Spectrometry Facility. Maria Jerome is thanked for pre-
1. Gordon JI. Honor thy gut symbionts redux. Science (1979). Am Assoc
paring histology samples, and Dr. Heidi Smith and Dr. Markus Adv Sci. 2012;336:1251–1253.
Dieser from the Center for Biofilm Engineering are acknowl- 2. Markle JGM, Frank DN, Mortin-Toth S, et al. Sex differences in the gut
edged for their assistance with microscopy. We are grateful to microbiome drive hormone-dependent regulation of autoimmunity.
Dr. Albert Parker for his insightful advice on our statistical ana- Science. 1979;2013(339):1084–1088.
lyses. Dr. Nathaniel Rieders andDr. SaraMaccagnano-Zacher pro- 3. Brettle H, Tran V, Drummond GR, et al. Sex hormones, intestinal
vided useful advice in collecting qBEI images. The Center for inflammation, and the gut microbiome: major influencers of the sex-
Advanced Orthopedic Research at Beth Israel Deaconess per- ual dimorphisms in obesity. Front Immunol. 2022;13:971048.
formed MCT analyses. We would like to extend our thanks to 4. Shi Y, Wei L, Xing L, et al. Sex difference is a determinant of gut
Kenna Brown and Brady Hislop for their assistance with tissue microbes and theirmetabolites SCFAs/MCFAs in high fat diet fed rats.
Curr Microbiol NLM. 2022;79(11):347.
harvesting and sample preparation. Funding for this study was
provided by the National Institutes of Health (NIGMS P20 5. Org E, Mehrabian M, Parks BW, et al. Sex differences and hormonal
effects on gut microbiota composition in mice. Gut Microbes. 2016;
GM103474, NIA R03 AG068680, and NIAMS 5R01AR073964) and 7(4):313–322.
the National Science Foundation (NSF 1554708 and 2140127). 6. Yurkovetskiy L, Burrows M, Khan AA, et al. Gender bias in autoimmu-
Any opinions, findings, or conclusions or recommendations nity is influenced by microbiota. Immunity. 2013;39(2):400–412.
n 1172 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
7. Kim YS, Unno T, Kim BY, Park MS. Sex differences in gut microbiota. transition. Bone. 2016;84:120–130. https://doi.org/10.1016/j.bone.
World J Men’s Health. 2020;38(1):48–60. 2015.12.055.
8. Hernandez CJ, Guss JD, Luna M, Goldring SR. Links between the 31. Zhang H, Majdeddin M, Gaublomme D, et al. 25-hydroxycholecalciferol
microbiome and bone. J Bone Miner Res. 2016;31(9):1638–1646. reverses heat induced alterations in bone quality in finisher broilers
9. Li J-Y, Jones RM, Paci ci R. Sex steroid de ciency—associated bone associated with effects on intestinal integrity and inflammation.
fi fi
loss is microbiota dependent and prevented by probiotics. J Clin J Anim Sci Biotechnol. 2021;12(1):1–21.
Invest. 2016;126(6):2049–2063. 32. Bonewald LF. The amazing osteocyte. J Bone Miner Res. 2011;26(2):
10. Vijay-KumarM, Aitken JD, Carvalho FA, et al. Metabolic syndrome and 229–238.
altered gut microbiota in mice lacking Toll-like receptor 5. Science 33. Schaffler MB, Cheung WY, Majeska R, Kennedy O. Osteocytes: master
(1979). Am Assoc Adv Sci. 2010;328(5975):228–231. orchestrators of bone. Calcif Tissue Int. 2014;94(1):5–24.
11. Pacifici R. T cells, osteoblasts, and osteocytes: interacting lineages key 34. Tiede-Lewis LM, Hulbert MA, Campos R, Dallas MR, Bonewald LF,
for the bone anabolic and catabolic activities of parathyroid hor- Dallas SL. Degeneration of the osteocyte network in the C57Bl/6
mone. Ann N Y Acad Sci. 2016;1364(1):11. mouse model of aging. Aging. 2017;9(10):2190–2208.
12. Pacifici R. Bone remodeling and the microbiome. Cold Spring Harb 35. Toth Z, Ward A, Tang SY, McBride-Gagyi S. Sexual differences in bone
Perspect Med. 2018;8(4):a031203. porosity, osteocyte density, and extracellular matrix organization
13. Li Y, Toraldo G, Li A, et al. B cells and T cells are critical for the preser- due to osteoblastic-specific Bmp2 deficiency in mice. Bone. 2021;
vation of bone homeostasis and attainment of peak bone mass 150:116002.
in vivo. Blood. 2007;109(9):3839–3848. 36. Dole NS, Yee CS, Mazur CM, Acevedo C, Alliston T. TGFβ regulation of
14. Tyagi AM, Yu M, Darby TM, et al. The microbial metabolite butyrate Perilacunar/canalicular remodeling is sexually dimorphic. J Bone
stimulates bone formation via T regulatory cell-mediated regulation Miner Res. 2020;35(8):1549–1561.
of WNT10B expression. Immunity Cell Press. 2018;49(6):1116– 37. Tremaroli V, Bäckhed F. Functional interactions between the gut
1131.e7. microbiota and host metabolism. Nature. 2012;489(7415):242–249.
15. Basu TK, Donaldson D. 6 intestinal absorption in health and disease: 38. Welhaven HD, Vahidi G, Walk ST, et al. The cortical bonemetabolome
micronutrients. Best Pract Res Clin Gastroenterol. 2003;17(6): of C57BL/6J mice is sexually dimorphic. JBMR Plus. 2022;6(7):10654.
957–979.
16. Yan J, Takakura A, Zandi-Nejad K, Charles JF. Mechanisms of gut 39. Fontaine CA, Skorupski AM, Vowles CJ, Anderson NE, Poe SA,
microbiota-mediated bone remodeling. Gut Microbes. 2018;9:84–92. Eaton KA. How free of germs is germ-free? Detection of bacterial con-
tamination in a germ free mouse unit. Gut Microbes. 2015;6(4):
17. Michigami T. Paracrine and endocrine functions of osteocytes. Clin 225–233.
Pediatr Endocrinol Rev. 2023;32(1):1–10.
40. Bouxsein ML, Boyd SK, Christiansen BA, Guldberg RE, Jepsen KJ,
18. Sjögren K, Engdahl C, Henning P, et al. The gut microbiota regulates Müller R. Guidelines for assessment of bone microstructure in
bone mass in mice. J Bone Miner Res. 2012;27(6):1357–1367. rodents using micro–computed tomography. J Bone Miner Res.
19. Li JY, Yu M, Pal S, et al. Parathyroid hormone-dependent bone forma- 2010;25(7):1468–1486.
tion requires butyrate production by intestinal microbiota. J Clin 41. Turner CH, Burr DB. Basic biomechanical measurements of bone: a
Investig. 2020;130(4):1767–1781. tutorial. Bone. 1993;14(4):595–608.
20. Ohlsson C, Nigro G, Boneca IG, Bäckhed F, Sansonetti P, Sjögren K. 42. Ritchie RO, Koester KJ, Ionova S, Yao W, Lane NE, Ager JW. Measure-
Regulation of bone mass by the gut microbiota is dependent on ment of the toughness of bone: a tutorial with special reference to
NOD1 and NOD2 signaling. Cell Immunol. 2017;317:55–58. small animal studies. Bone. 2008;43(5):798–812.
21. Hahn AK, Wallace CW, Welhaven HD, et al. The microbiomemediates 43. Chudoba T, Richter F. Investigation of creep behaviour under load
epiphyseal bone loss and metabolomic changes after acute joint during indentation experiments and its influence on hardness and
trauma in mice. Osteoarthr Cartil. 2021;29(6):882–893. modulus results. Surf Coat Technol. 2001;148(2–3):191–198.
22. Locantore P, Del Gatto V, Gelli S, Paragliola RM, Pontecorvi A. The 44. Oliver WC, Pharr GM. An improved technique for determining hard-
interplay between immune system and microbiota in osteoporosis. ness and elastic modulus using load and displacement sensing
Mediators Inflammation. 2020;2020:3686749. indentation experiments. J Mater Res. 1992;7(6):1564–1583.
23. Hrncir T, Stepankova R, Kozakova H, Hudcovic T, Tlaskalova-
Hogenova H. Gut microbiota and lipopolysaccharide content of the 45. Campbell SE, Ferguson VL, Hurley DC. Nanomechanical mapping of
diet in uence development of regulatory T cells: studies in germ-free the osteochondral interfacewith contactresonance forcemicroscopy
fl
mice. BMC Immunol. 2008;6:9. and nanoindentation. Acta Biomater. 2012;8(12):4389–4396.
24. Macpherson A, Drew J, Harris NL. Interactions between commensal 46. Boyde A, Travers R, Glorieux FH, Jones SJ. The mineralization density
intestinal bacteria and the immune system. Nat Rev Immunol. 2004; of iliac crest bone from children with osteogenesis imperfecta. Calcif
4(114):478–485. Tissue Int. 1999;64(3):185–190.
25. Novince CM, Whittow CR, Aartun JD, et al. Commensal gut micro- 47. Heveran CM, Ortega AM, Cureton A, et al. Moderate chronic kidney
biota immunomodulatory actions in bonemarrow and liver have cat- disease impairs bone quality in C57Bl/6J mice. Bone. 2016;86:1–9.
abolic effects on skeletal homeostasis in health. Sci Rep. 2017;7(1): 48. Campbell SE, Geiss RH, Feller SA, Ferguson VL. Tunable glass refer-
1–18. ence materials for quantitative backscattered electron imaging of
26. Yan J, Herzog JW, Tsang K, et al. Gutmicrobiota induce IGF-1 and pro- mineralized tissues. J Mater Res. 2012;27(19):2568–2577.
mote bone formation and growth. Proc Natl Acad Sci U S A. 2016; 49. Roschger P, Fratzl P, Eschberger J, Klaushofer K. Validation of quanti-
113(47):E7554–E7563. tative backscattered electron imaging for the measurement of min-
27. Castaneda M, Strong JM, Alabi DA, Hernandez CJ. The gut micro- eral density distribution in human bone biopsies. Bone. 1998;23(4):
biome and bone strength. Curr Osteoporos Rep. 2020;18:677–683. 319–326.
28. Yan J, Charles JF. Gut microbiome and bone: to build, destroy or 50. Unal M, Jung H, Akkus O. Novel Raman spectroscopic biomarkers
both? Physiol Behav. 2017;176(12):139–148. indicate that Postyield damage denatures Bone’s collagen. J Bone
Miner Res. 2016;31(5):1015–1025.
29. Atkins GJ, Welldon KJ, Wijenayaka AR, Bonewald LF, Findlay DM. Vita-
min K promotes mineralization, osteoblast-to-osteocyte transition, 51. Unal M, Ahmed R, Mahadevan-Jansen A, Nyman JS. Compositional
and an anticatabolic phenotype by γ-carboxylation-dependent assessment of bone by Raman spectroscopy. Analyst. 2021;146(24):
and-independent mechanisms. Am J Physiol Cell Physiol. 2009; 7444–7470.
297(6):1358–1367. 52. Unal M, Akkus O. Raman spectral classification of mineral-and
30. Yamamoto H, Ramos-Molina B, Lick AN, et al. Posttranslational pro- collagen-bound water’s associations to elastic and post-yield
cessing of FGF23 in osteocytes during the osteoblast to osteocyte mechanical properties of cortical bone. Bone. 2015;81:315–326.
Journal of Bone and Mineral Research GERM-FREE C57BL/6 MICE HAVE INCREASED BONE MASS AND ALTERED MATRIX PROPERTIES 1173 n
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
53. Vashishth D, Gibson GJ, Khoury JI, Schaffler MB, Kimura J, Fyhrie DP. 71. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and acti-
Influence of nonenzymatic glycation on biomechanical properties vation. Nature. 2003;423:337–342.
of cortical bone. Bone. 2001;28(2):195–201. 72. Poundarik AA, Diab T, Sroga GE, et al. Dilatational band formation in
54. Viguet-Carrin S, Farlay D, Bala Y, Munoz F, Bouxsein ML, Delmas PD. bone. Proc Natl Acad Sci. 2012;109(47):19178–19183.
An in vitro model to test the contribution of advanced glycation 73. Poundarik AA, Boskey A, Gundberg C, Vashishth D. Biomolecular reg-
end products to bone biomechanical properties. Bone. 2008;42(1): ulation, composition and nanoarchitecture of bone mineral. Sci Rep.
139–149. 2018;8(1):1–8.
55. Karim L, Moulton J, van Vliet M, et al. Bone microarchitecture, biome- 74. Hauschka P v, Lian JB, Gallop PM. Direct identification of the calcium-
chanical properties, and advanced glycation end-products in the binding amino acid, y-carboxyglutamate, in mineralized tissue. Proc
proximal femur of adults with type 2 diabetes. Bone. 2018;114:32–39. Natl Acad Sci. 1975;72(10):3925–3929.
56. Merlo K, Aaronson J, Vaidya R, Rezaee T, Chalivendra V, Karim L. In 75. Gundberg CM, Lian JB, Booth SL. Vitamin K-dependent carboxylation
vitro-induced high sugar environments deteriorate human cortical of osteocalcin: friend or foe? Adv Nutr. 2012;3:149–157.
bone elastic modulus and fracture toughness. J Orthop Res. 2020;
38(5):972–983. 76. Nikel O, Poundarik AA, Bailey S, Vashishth D. Structural role of osteo-
calcin and osteopontin in energy dissipation in bone. J Biomech.
57. Tang SY, Zeenath U, Vashishth D. Effects of non-enzymatic glycation 2018;80:45–52.
on cancellous bone fragility. Bone. 2007;40(4):1144–1151.
77. Inaba N, Sato T, Yamashita T. Low-dose daily intake of vitamin K
58. Gross J. Studies on the formation of collagen: I. properties and frac- 2 (Menaquinone-7) improves osteocalcin g-carboxylation: a double-
tionation of neutral salt extracts of normal Guinea pig connective tis- blind, randomized controlled trials. J Nutr Sci Vitaminol. 2015;61:
sue. J Exp Med. 1958;107(2):247. 471–480.
59. Carlson AK, Rawle RA, Adams E, Greenwood MC, Bothner B, June RK. 78. Cooper DML, Kawalilak CE, Harrison K, Johnston BD, Johnston JD.
Application of global metabolomic profiling of synovial fluid for oste- Cortical bone porosity: what is it, why is it important, and how can
oarthritis biomarkers. Biochem Biophys Res Commun. 2018;499(2): we detect it? Curr Osteoporos Rep. 2016;1:187–198.
182–188.
79. Augat P, Reeb H, Claes LE. Prediction of fracture load at different skel-
60. Jutila AA, Zignego DL, Hwang BK, et al. Candidate mediators of chon- etal sites by geometric properties of the cortical shell. J Bone Miner
drocyte mechanotransduction via targeted and untargeted metabo- Res. 1996;11(9):1356–1363.
lomic measurements. Arch Biochem Biophys. 2014;545:116–123.
80. Currey JD. The effect of porosity and mineral content on the Young’s
61. Unal M, Uppuganti S, Timur S, Mahadevan-Jansen A, Akkus O, modulus of elasticity of compact bone. J Biomech. 1988;21(2):
Nyman JS. Assessing matrix quality by Raman spectroscopy helps 131–139.
predict fracture toughness of human cortical bone. Sci Rep. 2019;9
(1):116–123. 81. Currey J. Incompatible mechanical properties in compact bone.
62. Fish EN. The X- les in immunity: sex-based differences predispose J Theor Biol. 2004;231(4):569–580.
fi
immune responses. Nat Rev Immunol. 2008;8:737–744. 82. Schaffler MB, Burr DB. Stiffness of compact bone: effects of porosity
63. Klein SL, Flanagan KL. Sex differences in immune responses. Nat Rev and density. J Biomech. 1988;21(1):13–16.
Immunol. 2016;16:626–638. 83. Hernandez CJ, Beaupré GS, Keller TS, Carter DR. The influence of bone
64. Jaillon S, Berthenet K, Garlanda C. Sexual dimorphism in innate volume fraction and ash fraction on bone strength and modulus.
immunity. Clin Rev Allergy Immunol. 2019;56:308–321. Bone. 2001;29(1):74–78.
65. ValerioMS, Kirkwood KL. Sexual dimorphism in immunity to Oral bac- 84. Boivin GY, Chavassieux PM, Santora AC, Yates J, Meunier PJ. Alendro-
terial diseases: intersection of neutrophil and osteoclast pathobiol- nate increases bone strength by increasing the mean degree of min-
ogy. J Dent Res. 2018;97:1416–1423. eralization of bone tissue in osteoporotic women. Bone. 2000;27(5):
687–694.
66. Mun SH, Jastrzebski S, Kalinowski J, et al. Sexual dimorphism in differ-
entiating osteoclast precursors demonstrates enhanced in amma- 85. Vose GP, Kubala AL. Bone strength-its relationship to x-ray-
fl
tory pathway activation in female cells. J Bone Miner Res. 2021; determined ash content. Hum Biol Hum Biol. 1959;31(3):261–270.
36(6):1104–1116. 86. Currey JD. Strain rate andmineral content in fracturemodels of bone.
67. Schwarzer M, Makki K, Storelli G, et al. Lactobacillus plantarum strain J Orthop Res. 1988;6(1):32–38.
maintains growth of infant mice during chronic undernutrition. Sci- 87. Fuller K, Chambers TJ. Effect of arachidonic acid metabolites on bone
ence. 2016;351(6275):854–857. resorption by isolated rat osteoclasts. J Bone Miner Res. 1989;4(2):
68. Delahunty KM, Shultz KL, Gronowicz GA, et al. Congenicmice provide 209–215.
in vivo evidence for a genetic locus that modulates serum insulin-like 88. Castellano R, Perruchot MH, Tesseraud S, et al. Methionine and cyste-
growth factor-I and bone acquisition. Endocrinology. 2006;147(8): ine deficiencies altered proliferation rate and time-course differenti-
3915–3923. ation of porcine preadipose cells. Amino Acids. 2017;49(2):355–366.
69. Guss JD, Taylor E, Rouse Z, et al. The microbial metagenome and 89. Lu J, WangM,Wang Z, Fu Z, Lu A, Zhang G. Advances in the discovery
bone tissue composition in mice with microbiome-induced reduc- of cathepsi. Inhibitors on bone resorption. J Enzyme Inhib Med
tions in bone strength. Bone. 2019;127:146–154. Chem. 2018;33:890–904.
70. Pathak JL, Bravenboer N, Luyten FP, et al. Mechanical loading 90. Niimi K, Takahashi E. New system to examine the activity and water
reduces inflammation-induced human osteocyte-to-osteoclast com- and food intake of germ-freemice in a sealed positive-pressure cage.
munication. Calcif Tissue Int. 2015;97(2):169–178. Heliyon. 2019;5(8):e02176.
n 1174 VAHIDI ET AL. Journal of Bone and Mineral Research
 15234681, 2023, 8, Downloaded from https://asbmr.onlinelibrary.wiley.com/doi/10.1002/jbmr.4835 by Montana State University Library, Wiley Online Library on [08/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License