RESEARCH ARTICLE Propionibacterium acnes biofilm is present in intervertebral discs of patients undergoing microdiscectomy Manu N. Capoor1,2*, Filip Ruzicka3, Jonathan E. Schmitz4, Garth A. James5, Tana Machackova2, Radim Jancalek6, Martin Smrcka7, Radim Lipina8, Fahad S. Ahmed2, Todd F. Alamin9, Neel Anand10, John C. Baird2, Nitin Bhatia11, Sibel Demir-Deviren12, Robert K. Eastlack13, Steve Fisher5, Steven R. Garfin14, Jaspaul S. Gogia15, Ziya L. Gokaslan16, Calvin C. Kuo17, Yu-Po Lee11, Konstantinos Mavrommatis18, Elleni Michu2, Hana Noskova2, Assaf Raz1, Jiri Sana2, A. Nick Shamie19, Philip S. Stewart5, Jerry L. Stonemetz20, Jeffrey C. Wang21, Timothy F. Witham22, Michael F. Coscia23, Christof Birkenmaier24, Vincent A. Fischetti1, Ondrej Slaby2* 1 Laboratory of Bacterial Pathogenesis and Immunology, Rockefeller University, New York, New York, United States of America, 2 Department of Molecular Oncology, Central European Institute of Technology (CEITEC), Masaryk University, Brno, Czech Republic, 3 Department of Microbiology, Faculty of Medicine, Masaryk university, St. Anne’s Faculty Hospital, Brno, Czech Republic, 4 Department of Pathology, Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America, 5 Center for Biofilm Engineering, Montana State University, Bozeman, Montana, United States of America, 6 Department of Neurosurgery, St. Anne’s University Hospital, Masaryk University, Brno, Czech Republic, 7 Department of Neurosurgery, University Hospital Brno, Masaryk University, Brno, Czech Republic, 8 Department of Neurosurgery, University Hospital Ostrava, Ostrava University, Ostrava, Czech Republic, 9 Department of Orthopedic Surgery, Stanford University Medical Center, Stanford University, Stanford, California, United States of America, 10 Cedars-Sinai Institute for Spinal Disorders, Los Angeles, California, United States of America, 11 Department of Orthopaedic Surgery, University of California Irvine, School of Medicine, Irvine, California, United States of America, 12 Spine Center, UCSF Medical Center, San Francisco, California, United States of America, 13 Scripps Clinic Division of Orthopedic Surgery, San Diego, California, United States of America, 14 Department of Orthopaedic Surgery, University of California San Diego, San Diego, California, United States of America, 15 Department of Orthopedic Surgery, Kaiser Permanente—San Jose Medical Center, San Jose, California, United States of America, 16 Department of Neurosurgery, The Warren Alpert Medical School of Brown University, Rhode Island Hospital, Providence, Rhode Island, United States of America, 17 Department of Orthopedic Surgery, Kaiser Permanente–Oakland Medical Center, Oakland, California, United States of America, 18 Celgene Corporation, Information Knowledge and Utilization, San Francisco, California, United States of America, 19 Department of Orthopaedic Surgery, David Geffen School of Medicine, University of California, Los Angeles, California, United States of America, 20 Department of Anesthesia, The Johns Hopkins Hospital, Baltimore, Maryland, United States of America, 21 Department of Orthopedic Surgery, University Southern California, Los Angeles, California, United States of America, 22 Department of Neurosurgery, The Johns Hopkins Hospital, Baltimore, Maryland, United States of America, 23 Department of Orthopedic Surgery, OrthoIndy Hospital, Indianapolis, Indiana, United States of America, 24 Department of Orthopedics, Physical Medicine & Rehabilitation, University of Munich (LMU), Munich, Germany * mcapoor@mail.rockefeller.edu (MNC); ondrej.slaby@ceitec.muni.cz (OS) Abstract Background In previous studies, Propionibacterium acnes was cultured from intervertebral disc tissue of ~25% of patients undergoing microdiscectomy, suggesting a possible link between chronic bacterial infection and disc degeneration. However, given the prominence of P. acnes as a skin commensal, such analyses often struggled to exclude the alternate possibility that PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 1 / 17 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPENACCESS Citation: Capoor MN, Ruzicka F, Schmitz JE, James GA, Machackova T, Jancalek R, et al. (2017) Propionibacterium acnes biofilm is present in intervertebral discs of patients undergoing microdiscectomy. PLoS ONE 12(4): e0174518. https://doi.org/10.1371/journal.pone.0174518 Editor: Holger Bru¨ggemann, Aarhus Universitet, DENMARK Received: January 17, 2017 Accepted: March 10, 2017 Published: April 3, 2017 Copyright: © 2017 Capoor et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the manuscript. Funding: DiscitisDx, Inc. provided support in the form of a research grant which was used to pay for culturing, microscopy, and materials. Neither DiscitisDX, Inc. nor any other commercial organization provided any support in the form of salaries for authors and did not have any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. KM’s these organisms represent perioperative microbiologic contamination. This investigation seeks to validate P. acnes prevalence in resected disc cultures, while providing microscopic evidence of P. acnes biofilm in the intervertebral discs. Methods Specimens from 368 patients undergoing microdiscectomy for disc herniation were divided into several fragments, one being homogenized, subjected to quantitative anaerobic culture, and assessed for bacterial growth, and a second fragment frozen for additional analyses. Colonies were identified by MALDI-TOF mass spectrometry and P. acnes phylotyping was conducted by multiplex PCR. For a sub-set of specimens, bacteria localization within the disc was assessed by microscopy using confocal laser scanning and FISH. Results Bacteria were cultured from 162 discs (44%), including 119 cases (32.3%) with P. acnes. In 89 cases, P. acnes was cultured exclusively; in 30 cases, it was isolated in combination with other bacteria (primarily coagulase-negative Staphylococcus spp.) Among positive speci- mens, the median P. acnes bacterial burden was 350 CFU/g (12 - ~20,000 CFU/g). Thirty- eight P. acnes isolates were subjected to molecular sub-typing, identifying 4 of 6 defined phylogroups: IA1, IB, IC, and II. Eight culture-positive specimens were evaluated by fluores- cence microscopy and revealed P. acnes in situ. Notably, these bacteria demonstrated a biofilm distribution within the disc matrix. P. acnes bacteria were more prevalent in males than females (39% vs. 23%, p = 0.0013). Conclusions This study confirms that P. acnes is prevalent in herniated disc tissue. Moreover, it provides the first visual evidence of P. acnes biofilms within such specimens, consistent with infection rather than microbiologic contamination. Introduction Although first more than 15 years ago, the relationship between intervertebral disc degenera- tion and chronic, primary infection by Proprionibacterium acnes remains controversial. In 11 independent studies published between 2001 and 2016, involving 1188 combined patients undergoing discectomy or microdiscectomy, this Gram-positive bacterial species was isolated from ~25% of resected disc specimens [1–11]. However, these studies had significant methodi- cal differences and the majority was statistically underpowered [1–9] Moreover, the use of qualitative microbiologic techniques—i.e. deeming a specimen positive or negative for bacterial growth without regard to colony counts—could have led to cultures that were falsely positive for P. acnes or other organisms. This is due to the concern for low-level bacterial contamina- tion from the surgical environment, the clinical laboratory, or the patients’ skin, as P. acnes is a nearly ubiquitous human commensal that can colonize the follicle and sebaceous unit at high levels [6, 12]. On the other hand, several of the previous studies reported a low prevalence of culture- positivity in resected lumbar discs [5, 6, 10]. In this light, even if P. acnes were truly present within a disc, the organism’s mode of growth and the culture techniques employed by the Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 2 / 17 commercial affiliation with Celgene did not play a role in the study. Competing interests: MNC, FSA, JCB, JLS, OS, JES, KM, and VAF have stock ownership or options in DiscitisDX, Inc. KM is an employee of Celgene Corporation. There are no other financial or non- financial competing interests. These affiliations do not alter the authors’ adherence to PLOS policies on sharing data and materials. laboratory might underestimate bacterial burden. P. acnes can be slow to grow and often proliferates in vivo as aggregated biofilms, which can be challenging to cultivate in vitro and require physical biofilm disassembly (e.g. through sonication or homogenization) prior to microbiologic plating [11–13]. As a result, standard specimen preparation and culture tech- niques could lead to false negative results. Based on these methodological issues, it is not surprising that the prevalence rate of cultured P. acnes in previous publications ranges from 0 to 44% [11]. In a recent study from the current authors [11], P. acnes was identified in 40% of 290 patients undergoing microdiscectomy for disc herniation. That study utilized quantitative cul- ture techniques and it represented the largest series of patients investigated to date. Neverthe- less, several methodical weaknesses remained to be addressed, and we had not yet provided direct evidence of P. acnes biofilms within the discs. Accordingly, in the current study, we sought to validate and extend our previous work with a subsequent (and larger) independent series of patients undergoing microdiscectomy for lum- bar herniation. This study characterizes the prevalence of P. acnes in resected disc tissue via an improved protocol for quantitative bacterial culture, along with molecular phylotyping of P. acnes isolates. Moreover, we conduct in situ fluorescence imaging of a set of specimens to dem- onstrate the distribution of the bacteria as a biofilm within the disc tissue. Methods Study design and patient characteristics Adults scheduled for microdiscectomy for symptomatic lumbar disc herniation between Janu- ary 2016 and November 2016 at St. Anne’s University Hospital (Brno, Czech Republic) and University Hospital Brno (Brno, Czech Republic) were prospectively screened immediately prior to surgery and consented for potential participation in this study. To summarize, inclu- sion criteria covered all adults undergoing microdiscectomy. Exclusion criteria were: immuno- logical compromise; traumatic herniations; the presence of an unknown radiographic mass; and inflammatory or rheumatologic disease. The inclusion and exclusion criteria are described in detail in Capoor et. al. 2016 [11]. Out of 386 patients approached, 8 declined to participate in the study and 5 patients were not included due to rheumatoid arthritis or antibiotic treatment for recurrent urine infection in the one month prior to surgery. Since we were not focused on the follow-up of patients, the only reason for drop-out from our study was zero or insufficient amount of the disc tissue available for microbiology culture. This situation occurred in 5 cases. The epidemiological/clinical data collection included: sex, age, intervertebral segment involved, type of herniation, history of previous spinal surgeries, prior epidural steroid injections, pre- operative pain scores (leg pain [months], back pain [months], NRS (Numerical rating scale for pain) back, NRS leg, Oswestry Disability Index), and development of post-operative discitis. Eth- ics Committee approvals were obtained for our study from the following hospitals: St. Anne’s University Hospital (Brno, Czech Republic) where Hospital Ethics Committee approval was granted (Reference 33V/2015) on June 10, 2015; and, University Hospital Brno (Brno, Czech Republic) where Hospital Ethics Committee approval was granted on May 13, 2015. This study was approved by the Institutional Review Boards of the two participating hospitals and written informed consent was obtained from each patient. Surgical specimen collection All disc samples were obtained using standard operating practices. Specimens were asepti- cally placed into a closed sterile sample cup to minimize the chances of post-resection con- tamination [11]. These cups were labeled and immediately transported to the Department Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 3 / 17 of Microbiology at St. Anne’s University Hospital (Brno, Czech Republic). Samples were sterilely divided into two fragments (processed within 2–4 hours post-surgery): the first was utilized immediately for quantitative anaerobic culture, while the second was frozen for future microscopy and other analyses. The size of the resected disc specimens ranged from 3x3x5 mm to 10x5x5 mm. Microbiologic culture The disc fragment for culture was weighed, placed into a Micro Bag (Seward) containing 4 ml of Viande-Levure medium, and homogenized with a Stomacher 80 (Seward) under asep- tic conditions. 100 μl of the resultant homogenate was inoculated onto Wilkins Chalgren Anaerobic Agar with 7% sheep’s blood and vitamin K (Hi Media Laboratories). An Anaero- bic Work Station Concept 400 (Ruskinn Technology) was utilized for culture; inoculated plates were incubated for 14 days at 37˚C with an atmosphere of 80% N2, 10% CO2, and 10% H2. The same amount of the homogenate was also cultured aerobically on Columbia Blood Agar (Oxoid) for 7 days at 37˚C in order to detect aerobic bacteria. Following incuba- tion, the bacterial colonies were counted and the quantity of each colonial morphotype was expressed as colony forming units (CFU) per gram of tissue using the Miles and Misra method [14]. MALDI-TOF mass spectrometry Taxonomic identification of the above colonies was conducted by matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). This analysis was performed on a common diagnostic platform, the MALDI Biotyper with FlexControl 3.4 software (Bruker Daltonik), according to manufacturer’s instructions. To summarize, single colonies were applied as a thin film onto a section of a MALDI 96-target plate, over- laid with 1 μl of 70% formic acid, and dried at room temperature. Dried bacteria were over- laid with 1 μl of matrix solution, saturated α-cyano-4-hydroxycinnamic acid solution in acetonitrile–water–trifluoroacetic acid (50:47.5:2.5, v/v), and allowed to dry before spectral acquisition. Mass spectra were processed using the BioTyper 3.1 software, and manufac- turer-recommended cut-off scores were employed for identification (2 indicating species- level identification; 1.7–1.999 indicating genus-level identification, and <1.7 indicating no identification). Colonies with isolates an initial score <1.7 were retested, and the highest score was used for identification. Confocal scanning laser microscopy and SYTO9 staining Ten frozen disc specimens were selected primarily by a sample size > 0.5 g. These included 8 P. acnes-only specimens (4 from men and 4 from women) with a bacterial load> 103 CFU/g (out of 38 total), as well as 2 negative controls with no culture growth. Frozen fragments were transported on dry ice to the Center for Biofilm Engineering at Montana State University (CDC PHS Permit 2016-05-119) for confocal laser scanning microscopy (CSLM). Disc tissue was defrosted and fixed using 4% paraformaldehyde (Electron Microscopy Science); cryoem- bedded in Optimal Cutting Temperature medium (Saukura Finetek); cryosectioned at -20˚C into 7–10 μm sections; and placed onto Superfrost Plus glass slides. For nucleic acid labeling, slides were stained with the fluorescent DNA maker SYTO9 (ThermoFisher Scientific) and imaged on a Leica SP5 confocal scanning laser microscope, with 3-D reconstruction by Imaris software. Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 4 / 17 Fluorescent in-situ hybridization Two fluorescent in-situ hybridization (FISH) probes were employed in this study: the general eubacterial 16S rRNA probe EUB338 (GCTGCCTCCCGTAGGAGT) and the P. acnes-specific 16S rRNA probe PAC16s598 (GCCCCAAGATTACACTTCCG). These oligonucleotides (Sigma-Aldrich) were labeled at both the 5’ and 3’ ends with either CY5 (for EUB338) or CY3 (for PAC16s598). The taxonomic specificity of these probes was first validated through experiments with cultured P. acnes, Staphylococcus aureus, S. epidermidis, and Pseudomonas aeruginosa. For FISH analysis, the resected discs were sectioned onto glass slides (as described above) and re-fixed with 4% parafor- maldehyde (20 minutes at room temperature), followed by a deionized water (DIW) rinse. Slides were next treated with 1 mg/mL lysozyme (Acros Organics) and 30 units/mL achromopeptidase (Wako) for 20 minutes at 37˚C in a humidified chamber. After another DIW wash, the sections were dehydrated in a graded ethanol series (50%, 80%, 100%; 3 minutes each) and dried with fil- tered compressed air. FISH probes (2ng/μL each, final concentration) were added to a hybridization buffer (900μL filter-sterilized H2O, 360μL 5M NaCl, 40μL 1M Tris/HCl, 700μL formamide, and 2μL 10% sodium dodecyl sulfate). Prepared slides were stained with the probes overnight at 46˚C, followed by 20 minutes at 48˚C in wash buffer (700μL 5M NaCl, 1mL 1M Tris/HCl, 50μL of 10% SDS, made up to 50 mL with filter-sterilized H2O). Slides were then rinsed with ice-cold water and dried with compressed air. A drop of Prolong Gold anti-fade solution (Life Technol- ogies) was added to the section, which was covered with a coverslip and allowed to dry over- night at room temperature. Sections were visualized with a Nikon Eclipse E800 microscope equipped with a CY3 and CY5 filter cube. P. acnes phylotype analysis Genomic DNA from P. acnes isolates was purified using the QIAamp DNA mini kit (Qiagen). Phylotyping was conducted according to the MLST8 scheme and determined by a recently described multiplex PCR assay [15]. Refer to the cited publication for primer information and amplification conditions. A C1000 TouchTM Thermal Cycler (Bio-Rad) was employed for PCR. Statistical analysis Culture positivity, bacterial identity, and quantitative organism burden (CFU/gram) were cor- related to the patients’ documented clinical parameters with the use of the Prism 5 software package (GraphPad Software, Inc.). Analyses of categorical variables were performed with a Fisher’s two-sided exact test, and analysis of patient age was performed with a non-parametric Mann-Whitney U test (significance level set at p = 0.05). Results Bacterial culture analysis Resected disc specimens from 368 patients with lumbar herniation were subjected to extended anaerobic culture. Bacterial growth was observed and identified by MALDI-TOF for 162 of 368 specimens (44%), with no colonies observed for the other 206. Among positive specimens, P. acnes was present in 119 cases (32.3%); and, non-P. acnes bacteria was present in 42 cases (11.4%). S. saccharolyticus comprised 11 (3%), S. epidermidus comprised 10 (2.7%), and S. hae- molyticus 3 (0.8%) of these 42 cases; and, all the remaining species represented either one or two cases. For specimens with growth of P. acnes, a majority (89/119, 75%) yielded only this organism, without any additional bacterial species present. Conversely, 30 specimens (34%) Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 5 / 17 demonstrated mixed growth of 2 or more bacterial species. Of these P. acnes with S. epidermi- dus, P. acnes with S. haemolyticus, P. acnes with S. hominis, and P. acnes with S. warneri each accounted for 4 cases (1.1%). 38 P. acnes cases (10.3%) were found to be 1000 CFU/g: 31 where the species was exclusive, 4 in combination with Staphylococcus (i.e., 2 with S. warneri, 1 with S. haemolyticus, and 1 with S. pasteuri), and 1 with P. granulosum. Also, 13 cases of other bacteria (3.5%) were found, in aggregate, to be1000 CFU/g, 5 of which were in combination with P. acnes. Of the remaining 8 cases (2.2%), 4 cases were Staphylococcus only (i.e., 2 were S. epidermidus, 1 of S. epidermidus with S. hominis, and 1 was S. warneri), 2 were primarily Streptococcus (i.e., 1 of S. mitis and 1 of S. mitis with S. parasanguinis. and A. graevenitz), 1 was C. tuberculostearicum, and 1 was Enterococcus gallinarum (refer to Table 1 for a detailed sum- mary of this information). Aerobic cultivation did not lead to any additional significant find- ings. Cultivation neither increases the number of positive samples nor extends the spectrum of detected microbes. Quantitative burden of P. acnes in disc specimens The observed organism burden from the 119 P. acnes-positive specimens varied significantly from case to case. Quantitative P. acnes counts ranged from 12 to 20952 CFU/g, with a median of 350 CFU/gram. We noted 38 cases (32%) with P. acnes colony counts 103 CFU/gram; 46 cases (39%) with 102–103 CFU/gram; and the remaining 35 cases (29%) with 101–102 (Fig 1). In situ determination of bacteria by CSLM Given the high burden of cultured P. acnes in many specimens, we next sought to investigate the in situ relationship of the organisms to the disc tissue. A set of 8 specimens with> 1000 CFU/g (along with 2 culture-negative controls) were selected for visualization, first via confo- cal scanning laser microscopy (CSLM) and the SYTO9 DNA dye. Bacterial biofilms were detected in 7 out of 8 culture-positive specimens tested (Table 2). A three-dimensional recon- struction of a typical biofilm is provided in Fig 2A (from Sample 4). The bacteria are present within the body of the herniated intervertebral disc, not on the surface (as would be expected for a perioperative contaminant that became associated with the tissue during resection). No bacteria were visualized in the culture-negative control samples. In situ identification of P. acnes by FISH To complement the SYTO9 images, further fluorescence microscopy was conducted with 16S rRNA FISH probes targeting either a ubiquitous eubacterial sequence (EUB338) or P. acnes specifically (PAC16s598). These probes were applied to all 8 of the disc specimens described above, for which > 1000 CFU/g of P. acnes were cultured and biofilms were visualized by SYTO9 staining and CSLM with the exception of Sample 9. The presence of bacterial biofilms was confirmed in 6 of the 8 specimens with the EUB338 probe, which also stained positively with PAC16s598. Two examples of images (with both probes) are depicted in Fig 2 and Fig 3. Overall, these data further demonstrate the presence of P. acnes biofilm-aggregates in resected disc specimens with corresponding culture positivity. Phylotyping of P. acnes isolates from intervertebral discs We phylotyped 38 isolates of P. acnes from discs with>1000 CFU/g to gauge whether any clade-specific associations exist. Type IA1 P. acnes was identified in 15 (39%) cases, type IB in 9 (24%) cases, type IC in 1 (3%) case, and type II in 13 (34%) cases. No dominant phylotype was Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 6 / 17 Table 1. Summary of the microorganisms isolated in 162 cases from 368 patient intervertebral disc specimens by anaerobic culture.  1000 CFU/g Aggregate of Positive Cases P. acnes Other Bacteria Isolated microorganism N % N % N % Propionibacterium acnes cases 119 32.3% 38 10.3% 5 1.4% P. acnes only 89 24.2% 31 8.4% P. acnes with Staphylococcus only 22 6.0% 5 1.4% 4 1.1% P. acnes, S. aureus 1 0.3% P. acnes, S. capitis 2 0.5% P. acnes, S. epidermidus 4 1.1% 1 0.3% P. acnes, S. haemolyticus 4 1.1% 2 0.5% 1 0.3% P. acnes, S. hominis 4 1.1% P. acnes, S. pasteuri 1 0.3% 1 0.3% 1 0.3% P. acnes, S. (unspecified) 1 0.3% P. acnes, S. warneri 4 1.1% 1 0.3% 2 0.5% P. acnes, S. intermedius 1 0.3% P. acnes with other 8 2.2% 2 0.5% 1 0.3% P. acnes, P. granulosum 1 0.3% 1 0.3% 1 0.3% P. acnes, P. granulosum, F. magna 1 0.3% 1 0.3% P. acnes, P. acidifaciens, S. hominis 1 0.3% P. acnes, S. epidermidus, S.viridans 1 0.3% P. acnes, S. haemolyticus, S. oralis 1 0.3% P. acnes, S. hominis, Paenibacillus 1 0.3% P. acnes, S. mitis 1 0.3% P. acnes, S. oralis, Veilonella dispar 1 0.3% Non-P. acnes bacteria cases 43 11.7% 8 2.2% Staphylococcus only 32 8.7% 4 1.1% S. capitis 1 0.3% S. epidermidus. 7 1.9% 2 0.5% S. epidermidus. S. haemolyticus 1 0.3% S. epidermidus. S. hominis 1 0.3% 1 0.3% S. haemolyticus 3 0.8% S. hominis 2 0.5% S. lugdunensis 1 0.3% S. pasteuri 2 0.5% S. saccharolyticus 11 3.0% S. (unspecified) 2 0.5% S. warneri 1 0.3% 1 0.3% Staphylococcus with other 3 0.8% S. epidermidus, A. odontolyticus 1 0.3% S. haemolyticus, Arthrobacter (unspecified) 1 0.3% S. haemolyticus, Rothia amarae 1 0.3% Streptococcus 3 0.8% 2 0.5% S. mitis 1 0.3% 1 0.3% S. viridans 1 0.3% S. mitis, S. Parasanguinis., A. graevenitz 1 0.3% 1 0.3% Corynebacterium 2 0.5% 1 0.3% C. minutissimum 1 0.3% (Continued ) Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 7 / 17 identified in either the total group of 38 strains or the subset with visualized biofilms in re- sected discs. Patient characteristics and Propionibacterium acnes positivity A total of 368 patients were enrolled (222 males and 146 females) in the study, at an average age of 49.3 ± 13.6 years and an age range extending from 20 to 83. Between the two surgical Table 1. (Continued)  1000 CFU/g Aggregate of Positive Cases P. acnes Other Bacteria Isolated microorganism N % N % N % C. tuberculostearicum 1 0.3% 1 0.3% Other 3 0.8% 1 0.3% Agromyces (unspecified) 1 0.3% Enterococcus gallinarum 1 0.3% 1 0.3% Rothia dentocariosa 1 0.3% Total 162 44.0% 38 10.3% 13 3.5% Notes: for P. acnes 1000 CFU/g applies to that species; for all other bacteria listed, an aggregate of the species found is used. “(unspecified)” refers to a species not identified within the preceding genus. https://doi.org/10.1371/journal.pone.0174518.t001 Fig 1. Distribution of P. acnes colony counts in culture-positive disc tissue specimens. https://doi.org/10.1371/journal.pone.0174518.g001 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 8 / 17 centers, 245 patients were enrolled at University Hospital Brno and 123 at St. Anne’s Univer- sity Hospital; there were no significant differences between the two centers with regards patient age, sex, or disease-specific clinical data. A medical history of previous spinal surgery was noted in 58 (16%) of cases, though none of the patients developed clinically evident post- operative discitis after these surgeries. Table 2. Characteristics of the disc samples evaluated by microscopic methods. Previous Sample SYTO-9 FISH Sample CFU/ Sample Spine Weight Biofilm Biofilm Number gram Description Surgery mg observed observed 1 0 Control No 950 No No 2 0 Control No 1070 No No 3 1097 P. acnes only No 2480 Yes No 4 9016 P. acnes only No 1930 Yes Yes 5 3977 P. acnes only No 1770 Yes Yes 6 1378 P. acnes only No 900 Yes Yes 7 2069 P. acnes only No 580 Yes Yes 8 1193 P. acnes only No 570 Yes Yes 9 3482 P. acnes only No 1700 No * Yes 10 4073 P. acnes only No 550 Yes No * Individual bacteria were observed. https://doi.org/10.1371/journal.pone.0174518.t002 Fig 2. Visualization of bacterial biofilm in the disc tissue by CSLM and confirmation of P. acnes by FISH. A. Three dimensional reconstructed CSLM image of biofilm bacteria stained with a DNA stain (SYTO9, green) in a disc tissue sample (#4, Table 2). B-C. The presence of P. acnes biofilms in this sample verified using FISH. Epifluorescence micrographs of a biofilm cluster showing red fluorescence from the CY5-labeled EUB338 general eubacterial probe (B) and green fluorescence from the CY3-labled P. acnes-specific probe (C). Co-localization of the red and green fluorescence indicates that all of the bacteria in this biofilm were P. acnes. https://doi.org/10.1371/journal.pone.0174518.g002 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 9 / 17 To provide clinical context to the microbiologic culture results, we sought to correlate P. acnes positivity to the patients’ clinical parameters. P. acnes positive patients were significantly younger than P. acnes negative patients (46.7 versus 50.5 years; p = 0.0380). Roughly 39% of 222 males were P. acnes positive compared to 23% of 146 females (p = 0.0013). There were no significant differences between P. acnes positive and negative patients in prevalence of previous spinal surgery, distribution of herniation type, affected intervertebral level, or pre-surgical pain scores. Results are summarized in Table 3. Discussion Over the last 15 years, it has been hypothesized that intervertebral disc degeneration and the accompanying chronic lower back pain may be associated—at least in some cases—with chronic subclinical bacterial infection by P. acnes [16]. A recently described animal model demonstrates the ability of P. acnes to induce disc degeneration [17, 18]. However, in microbi- ologic culture data, contamination is difficult to exclude entirely, as P. acnes is a common skin commensal. The current study seeks to resolve this dilemma through an improved protocol for quantitative bacterial culture, in situ imaging of resected disc tissue, and molecular phylo- typing of P. acnes isolates. In our previous study [6], we were first to utilize quantitative bacterial culture for detection of P. acnes in disc samples. Here we addressed several weaknesses: (i) weighing the disc tissue prior to homogenization to allow for a precise CFU/gram determination, rather than CFU/ml homogenate; (ii) utilizing a Stomacher 80 for disc tissue homogenization, rather than a manual Fig 3. Visualization of P. acnes biofilm in the disc tissue by use of FISH. A. This color-combined image shows the “pocket” of green fluorescent P. acnes cells (biofilm) near the center right of the image (disc tissue sample #8, Table 2). The presence of P. acnes biofilms in this sample was verified using FISH. B-C. Red fluorescence is the general eubacterial probe (B) and green is the P. acnes probe (C). The B/C image is a zoom of A showing fluorescence from the red and green channels separately. Almost all of the cells in A are emitting both red and green fluorescence indicating that they are P. acnes. https://doi.org/10.1371/journal.pone.0174518.g003 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 10 / 17 mortar and pestle; (iii) increasing the plating volume from 10 μl (using a loop) to 100 μl (using a pipette); and (iv) confirmation of bacterial identity by MALDI-TOF MS, rather than bio- chemical tests. These improvements can help facilitate a higher level of standardization in the future, providing investigators with means for inter-study reproducibility and comparability. In particular, the inclusion of a biofilm disassembly step—such as tissue homogenization Table 3. Patient and clinical characteristics in relation to P. acnes positivity. P. acnes P. acnes Positive Negative Parameters N % N % N % p-value Number of patients 368 100% 119 32% 249 68% Male 222 60% 86 39% 136 61% 0.0012 Female 146 40% 33 23% 113 77% Age Median ± SD 49.3 ± 13.6 y 46.7 ± 12.4 y 50.5 ± 13.7 y 0.0145 Previous disc surgery Yes 58 16% 20 34% 38 66% No 310 84% 99 32% 211 68% Type of herniation Protrusion 55 15% 15 27% 40 73% Extrusion 181 49% 57 31% 124 69% Sequestration 132 36% 47 36% 85 64% Intervertebral level Multiple level proceduresA 17 5% 7 41% 10 59% L1/L2 1 0% 0 0% 1 100% L2/L3 9 2% 0 0% 9 100% L3/L4 28 8% 6 21% 22 79% L4/L5 149 40% 55 37% 94 63% L5/L6 5 1% 2 40% 3 60% L5/S1 159 43% 49 31% 110 69% Presurgical Pain Scores (All patients) Back Pain Number of patients 298 81% 106 36% 192 64% Duration, Months ± SD 16.2 ± 41.1 m 15.8 ± 35.2 m 16.5 ± 44.2 m Leg Pain Number of patients 67 18% 15 22% 52 78% Duration, Months ± SD 6.1 ± 8.9 m 7.5 ± 14.8 m 5.6 ± 6.5 m Φ NRS Back Number of patients 79 21% 18 23% 61 77% Φ NRS Score, Median ± SD 4.8 ± 2.1 5.4 ± 2.3 4.6 ± 2.1 Φ NRS Leg Number of patients 71 19% 17 24% 54 76% Φ NRS Score, Median ± SD 6.1 ± 1.8 6.4 ± 2.2 6.0 ± 1.7 Oswestry Disability Index Number of patients 85 23% 21 25% 64 75% Oswestry Score, Median ± SD 40.3 ± 17.7 45.4 ± 18.2 42.9 ± 17.7 A These procedures are excluded in the disc levels that follow. https://doi.org/10.1371/journal.pone.0174518.t003 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 11 / 17 through the use of a Stomacher—is a component we believe is crucial for cultures to accurately reflect tissue burden and avoid false negatives. With this improved culture protocol, we sought to confirm the prevalence of cultured P. acnes observed in our previous study [6], this time with an even larger population of patients undergoing microdiscectomy for lumbar disc herniation. In comparison to this earlier work, we observed a slightly lower prevalence rate of P. acnes (32% vs. 40%), which may be a result of the improved methodology and mainly utilizing a Stomacher 80 that is less vulnerable to introduce contamination than mortar and pestle, which was used for disc tissue homogenization in our previous study. Overall, both studies are in agreement with a majority of previous publications that describe P. acnes as the species most frequently isolated from lumbar disc tissue by anaero- bic culture, including Stirling et al. (44%) [9], Arndt et al. (35%) [4], and Albert et al. (40%). The observed colony-counts in the 119 P. acnes positive specimens ranged significantly, from 12 to 20952 CFU/gram (median = 350 CFU/gram). Although one might expect that true infections are more likely associated with higher colony-counts, we sought to provide direct visual confirmation of P. acnes biofilm. We selected 103 CFU/g as a positivity threshold to attempt fluorescence microscopy, although samples with lower bacterial counts could certainly include true positives, as well (Table 2). To our knowledge, this study represents the first three- dimensional reconstruction of an intervertebral disc biofilm by use of CSLM, as well as direct confirmation of P. acnes biofilm by organism-specific FISH (Fig 2 and Fig 3) [19]. Even at a tissue burden of 103 CFU/g, identifying organisms in histologic section represents a distinct challenge, as they can readily evade visual detection at this level. Our ability to ob- serve biofilms in 7/8 specimens suggests that the actual bacterial burden may exceed the mea- sured CFU/g values, even with the biofilm disassembly step. It is important to note that, unless a homogenization step disperses a biofilm entirely to individual organisms (highly unlikely), a CFU/g measurement will be less than the true organism/gram value. In fact, colony counts could further underestimate the in situ bacterial burden if the biofilm contains a mix of viable and nonviable organisms (which histologic observations cannot assess). In either case, our findings highlight the need for laboratory procedures that take into account the biofilm mode of growth. Because disc specimens were cryoembedded as intact fragments, one would expect contamination to be limited to the surfaces of the specimens. Instead, bacteria were observed in the interior of the frozen blocks. This distribution of P. acnes within the body of the inter- vertebral disc fragment provides strong evidence against contamination from the skin or exter- nal environment. Given that FISH sensitivity is lower than DNA staining with SYTO, it is not unexpected that with respect to case 3 and 10 we did not confirm the biofilm observed with DNA stain by FISH. We further applied the MLST8 phylotyping scheme that distinguishes between P. acnes strains classically associated with inflammation/acne and those associated with benign—or perhaps even beneficial—skin colonization [20]. Type IA1 is commonly found in abundance in inflamed skin, whereas Type II is generally associated with blood, endodontic infections, and normal skin [20]. Focusing on strains cultured in high density (>1000 CFU/g), we ob- served a distribution of phylotypes rather than a single predominance. The results in this study are similar to those of Rolasson et. al. [21], who (through single-locus recA analysis) observed that 50% of disc isolates belonged to phylotype II (34% here) and 42% to phylotype IA1 (39% here) [9]. By contrast, whereas our study detected 24% phylotype IB, Rolasson et. al. observed only 9%. Together, these studies suggest that no specific P. acnes phylotype is more prone to disc infection, although continued characterization of disc isolates will provide a more detailed phylotype distribution. Finally, we evaluated potential associations between P. acnes culture positivity and the clini- cal parameters of studied patients. In agreement with our previous study [6], patients with P. Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 12 / 17 acnes culture positivity were younger than culture-negative patients. One explanation for these findings is that P. acnes might accelerate age-related disc degenerative and associated symp- toms. Furthermore, we observed a significantly higher prevalence of P. acnes in disc specimens from males, a finding whose significance remains to be elucidated. From a clinical utility and outcomes perspective, pre-surgical pain scores did not discriminate between P. acnes positive and P. acnes negative patients. However, long-term post-surgical patient reported outcomes scores may provide further insight in this regard. Overall, one of the most significant implications of our findings is the way they challenge traditional paradigms of infection (typically inflammatory and pathological) versus coloniza- tion (non-inflammatory and physiological). Intervertebral discs are traditionally viewed as sterile spaces, so the presence of viable bacteria either (1) represents a non-physiologic process or (2) re-defines the anatomic boundaries of the normal human microbiome. The association of these organisms with disc herniation—as either an upstream or downstream event—sug- gests the former. While the organisms do not appear to induce a leukocytic infiltrate, the criti- cal question facing clinicians remains unresolved: might they otherwise contribute to the pain symptoms of chronic lower back pain? An additional noteworthy finding of the current study, as well previous publications [1– 11], was the isolation of Gram-positive bacteria other than P. acnes, specifically Staphylococci from the resected discs. Although not closely related phylogenetically, P. acnes and Staphylo- cocci share certain functional traits, such as their ability to colonize the skin and the propensity of various species/strains to form biofilms [22]. In our 368 patient study we cultured P. acnes in 119 cases and Staphylococci in 61 total cases. Of the 8 cases of Staphylococci with colony counts 1000 CFU/g no Staphylococci species appeared more than twice. On other hand, P. acnes with colony counts 1000 CFU/g was isolated in 38 cases. Therefore, we conclude that P. acnes is the only significant species cultivated from the disc. The current study has several limitations that could be addressed in future work. Although we performed MLST8 typing of isolates, higher resolution sequencing of additional strains may be needed to determine whether any distinct clades (or other genetic determinants) are associated with disc colonization/infection. P. acnes populates several cutaneous niches, but can also colonize the upper respiratory mucosa, gastrointestinal tract, conjunctiva, and exter- nal ear canal. The organism is likewise associated with device-associated infections, prostate cancer, and sarcoidosis [23]. However, although 119 genomes of P. acnes are currently avail- able in Genbank [24, 25], a large predominance represent skin isolates. As a result, molecular methods to phylotype P. acnes strains are potentially biased and could underestimate the diver- sity of strains from other body sites. In this light, additional sequencing of disc isolates could provide general insight into the population structure of the species. From a clinical perspective, our study only collected pre-operative pain scores. To evaluate potential clinical utility, studies analyzing both pre- and post-surgical pain scores in relation to P. acnes counts (CFU/g) have to be conducted. Also, studies on patients who undergo a second disc surgery, due to failure of their first procedure, could support the potential clinical utility of P. acnes detection. In this subset of patients, it would be insightful to compare quantitative data between the procedures, especially if CFU/g or other molecular values were higher for the second surgery. For the broader population of patients experiencing chronic lower back pain [26, 27] it will be important to determine whether P. acnes is exclusive to the herniated portion of the disc tissue (i.e., in specific locations within a disc) or distributed throughout the whole disc. A study utilizing disc tissue from spinal fusion surgeries could provide necessary insight. The preceding paragraph also alludes to an inherent limitation of the research strategy underlying our manuscript, which should be understood in order not to make conclusions that are currently unsupported by our data. We have studied disc material from patients Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 13 / 17 undergoing lumbar disc surgery either because of failed conservative treatment or because of clinically relevant motor deficits. Doing so permitted us to perform a large-scale epidemiologi- cal study without requiring volunteers to undergo an investigatory procedure. Decompressive surgery for herniated nucleus pulposus typically targets radicular symptoms (paralysis, intractable neuropathic pain) and not low back pain, even though low back pain may be a minor component of these patients’ overall complaints. The immediate and short- term success of disc surgery is measured by the alleviation of these radicular symptoms and if a subset of these patients’ progress to become chronic low back pain (CLBP) patients, it is not typically in the immediate follow-up. So in essence, our findings deliver an epidemiological sit- uation report on a selective group of middle-aged adults with specific consequences of Degen- erative Disc Disease (DDD) that are not necessarily representative of the population at large and most probably not of the typical CLBP patient or the failed back surgery patient / failed fusion patient. It would therefore be premature on the basis of our current data to claim that there is a direct link between low-grade disc infections with P. acnes and CLBP or failed lumbar arthrodesis surgery, even though there is an increasing body of literature pointing into that direction [28–30]. P. acnes behaves rather differently from most other bacterial pathogens. In contrast with rapidly progressive pyogenic infections that result in severely septic conditions, P. acnes infec- tions tend to result in slow, low-grade infections [31–34]. The germ has also been tied to dis- ease conditions that carry immunological aspects such as SAPHO syndrome and sarcoidosis [35–42]. P. acnes may in certain situations become an intracellular infectious agent that can survive and even travel within human macrophages [43, 44]. At this time, though the findings are suggestive, we cannot, and do not, recommend all patients undergoing discectomy send disc material for culture as current routine lab culturing may not be sufficient to indicate an infection. Additionally, until trials are done, we do not recommend antibiotics are needed. Further assessments may identify subsets of individuals where these two points could be considered. In conclusion, this represents the largest study to date demonstrating a high prevalence of P. acnes in the disc tissue of patients undergoing microdiscectomy. Moreover, it provides the first microscopic evidence of P. acnes biofilm in the resected lumbar spine disc tissue. It is still possible that, among P. acnes culture-positive specimens, some originated through periopera- tive contamination. However, given the specimens with a high organism burden and the microscopic evidence of biofilms, we conclude that at least a sub-set of herniated intervertebral discs truly become populated with P. acnes. Supporting information S1 File. Underlying Data. (XLSX) Author Contributions Conceptualization: MNC FR JES GJ TM RJ MS RL FSA TFA NA JCB NB SDD RKE SF SG JSG ZLG CCK YL KM EM HN AR JS ANS PSS JLS JCW TW MFC CB VAF OS. Data curation: MNC FR RJ MS FSA OS TM EM JS JCB GJ PSS SF. Formal analysis: MNC FR JES GJ RJ MS FSA OS TM JS CB JCB SF PSS EM AR. Funding acquisition: MNC OS FR GJ RJ MS FSA PSS. Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 14 / 17 Investigation: MNC FR JES GJ TM RJ MS FSA JCB SF EM HN AR JS OS. Methodology: MNC FR JES GJ RJ MS FSA TFA OS KM AR JS PSS JLS ZLG TW MFC CB VAF OS SDD JCW. Project administration: OS MNC. Resources: MNC FR GJ RJ MS FSA PSS OS. Supervision: MNC OS CB VAF GJ PSS. Validation: MNC FR GJ TM RJ MS FSA SF HN JS PSS OS. Visualization: MNC FR JES GJ TM RJ MS RL FSA TFA NA JCB NB SDD RKE SF SG JSG ZLG CCK YL KM EM HN AR JS ANS PSS JLS JCW TW MFC CB VAF OS. Writing – original draft: MNC JES GJ FSA JCB JS KM CB OS. Writing – review & editing: MNC FR JES GJ TM RJ MS RL FSA TFA NA JCB NB SDD RKE SF SG JSG ZLG CCK YL KM EM HN AR JS ANS PSS JLS JCW TW MFC CB VAF OS. References 1. Agarwal V, Golish SR, Alamin TF. Bacteriologic culture of excised intervertebral disc from immunocom- petent patients undergoing single level primary lumbar microdiscectomy. J Spinal Disord Tech. 2011; 24(6):397–400. https://doi.org/10.1097/BSD.0b013e3182019f3a PMID: 21150662 2. Aghazadeh J, Salehpour F, Ziaeii E, Javanshir N, Samadi A, Sadeghi J, et al. Modic changes in the adjacent vertebrae due to disc material infection with Propionibacterium acnes in patients with lumbar disc herniation. Eur Spine J. 2016. 3. Albert HB, Lambert P, Rollason J, Sorensen JS, Worthington T, Pedersen MB, et al. Does nuclear tis- sue infected with bacteria following disc herniations lead to Modic changes in the adjacent vertebrae? Eur Spine J. 2013; 22(4):690–6. PubMed Central PMCID: PMCPMC3631023. https://doi.org/10.1007/ s00586-013-2674-z PMID: 23397187 4. Arndt J, Charles YP, Koebel C, Bogorin I, Steib JP. Bacteriology of degenerated lumbar intervertebral disks. J Spinal Disord Tech. 2012; 25(7):E211–6. https://doi.org/10.1097/BSD.0b013e318269851a PMID: 22832554 5. Ben-Galim P, Rand N, Giladi M, Schwartz D, Ashkenazi E, Millgram M, et al. Association between sciat- ica and microbial infection: true infection or culture contamination? Spine (Phila Pa 1976). 2006; 31 (21):2507–9. 6. Carricajo A, Nuti C, Aubert E, Hatem O, Fonsale N, Mallaval FO, et al. Propionibacterium acnes con- tamination in lumbar disc surgery. J Hosp Infect. 2007; 66(3):275–7. https://doi.org/10.1016/j.jhin.2007. 04.007 PMID: 17573158 7. Coscia MF, Wack M, Denys G. Low Virulence Bacterial Infections of Intervertebral Discs and the Resul- tant Spinal Disease Processes. Abstract from Scoliosis Research Society (SRS) Annual Meeting. 2003. 8. Stirling A, Rafiq M, Mathur K, Elliot TS, Worthington T, Lambert PA. Association Between Sciatica and Skin Commensals. Journal of Bone and Joint Surgery. 2002; 84-B(Supplement II):147. 9. Stirling A, Worthington T, Rafiq M, Lambert PA, Elliott TS. Association between sciatica and Propioni- bacterium acnes. Lancet. 2001; 357(9273):2024–5. https://doi.org/10.1016/S0140-6736(00)05109-6 PMID: 11438138 10. Rigal J, Thelen T, Byrne F, Cogniet A, Boissiere L, Aunoble S, et al. Prospective study using anterior approach did not show association between Modic 1 changes and low grade infection in lumbar spine. Eur Spine J. 2016; 25(4):1000–5. https://doi.org/10.1007/s00586-016-4396-5 PMID: 26818032 11. Capoor MN, Ruzicka F, Machackova T, Jancalek R, Smrcka M, Schmitz JE, et al. Prevalence of Propio- nibacterium acnes in Intervertebral Discs of Patients Undergoing Lumbar Microdiscectomy: A Prospec- tive Cross-Sectional Study. PLoS One. 2016; 11(8):e0161676. PubMed Central PMCID: PMCPMC4990245. https://doi.org/10.1371/journal.pone.0161676 PMID: 27536784 12. Lee MJ, Pottinger PS, Butler-Wu S, Bumgarner RE, Russ SM, Matsen FA 3rd. Propionibacterium per- sists in the skin despite standard surgical preparation. J Bone Joint Surg Am. 2014; 96(17):1447–50. https://doi.org/10.2106/JBJS.M.01474 PMID: 25187583 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 15 / 17 13. Bayston R, Ashraf W, Barker-Davies R, Tucker E, Clement R, Clayton J, et al. Biofilm formation by Pro- pionibacterium acnes on biomaterials in vitro and in vivo: impact on diagnosis and treatment. J Biomed Mater Res A. 2007; 81(3):705–9. https://doi.org/10.1002/jbm.a.31145 PMID: 17187384 14. Miles AA, Misra SS, Irwin JO. The estimation of the bactericidal power of the blood. J Hyg (Lond). 1938; 38(6):732–49.PubMed Central PMCID: PMCPMC2199673. 15. Barnard E, Nagy I, Hunyadkurti J, Patrick S, McDowell A. Multiplex touchdown PCR for rapid typing of the opportunistic pathogen Propionibacterium acnes. J Clin Microbiol. 2015; 53(4):1149–55. PubMed Central PMCID: PMCPMC4365214. https://doi.org/10.1128/JCM.02460-14 PMID: 25631794 16. Urquhart DM, Zheng Y, Cheng AC, Rosenfeld JV, Chan P, Liew S, et al. Could low grade bacterial infec- tion contribute to low back pain? A systematic review. BMC Med. 2015; 13:13. PubMed Central PMCID: PMCPMC4320560. https://doi.org/10.1186/s12916-015-0267-x PMID: 25609421 17. Dudli S, Liebenberg E, Magnitsky S, Miller S, Demir-Deviren S, Lotz JC. Propionibacterium acnes infected intervertebral discs cause vertebral bone marrow lesions consistent with Modic changes. J Orthop Res. 2016; 34(8):1447–55. https://doi.org/10.1002/jor.23265 PMID: 27101067 18. Chen Z, Zheng Y, Yuan Y, Jiao Y, Xiao J, Zhou Z, et al. Modic Changes and Disc Degeneration Caused by Inoculation of Propionibacterium acnes inside Intervertebral Discs of Rabbits: A Pilot Study. Biomed Res Int. 2016; 2016:9612437. PubMed Central PMCID: PMCPMC4746301. https://doi.org/10.1155/ 2016/9612437 PMID: 26925420 19. Han A, Zenilman JM, Melendez JH, Shirtliff ME, Agostinho A, James G, et al. The importance of a multi- faceted approach to characterizing the microbial flora of chronic wounds. Wound Repair Regen. 2011; 19(5):532–41. PubMed Central PMCID: PMCPMC3227014. https://doi.org/10.1111/j.1524-475X.2011. 00720.x PMID: 22092791 20. McDowell A, Valanne S, Ramage G, Tunney MM, Glenn JV, McLorinan GC, et al. Propionibacterium acnes types I and II represent phylogenetically distinct groups. J Clin Microbiol. 2005; 43(1):326–34. PubMed Central PMCID: PMCPMC540145. https://doi.org/10.1128/JCM.43.1.326-334.2005 PMID: 15634990 21. Rollason J, McDowell A, Albert HB, Barnard E, Worthington T, Hilton AC, et al. Genotypic and antimi- crobial characterisation of Propionibacterium acnes isolates from surgically excised lumbar disc hernia- tions. Biomed Res Int. 2013; 2013:530382. PubMed Central PMCID: PMCPMC3771251. https://doi. org/10.1155/2013/530382 PMID: 24066290 22. Oliveira F, Lima CA, Bras S, Franca A, Cerca N. Evidence for inter- and intraspecies biofilm formation vari- ability among a small group of coagulase-negative staphylococci. FEMS Microbiol Lett. 2015; 362(20). 23. Perry A, Lambert P. Propionibacterium acnes: infection beyond the skin. Expert Rev Anti Infect Ther. 2011; 9(12):1149–56. https://doi.org/10.1586/eri.11.137 PMID: 22114965 24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990; 215(3):403–10. https://doi.org/10.1016/S0022-2836(05)80360-2 PMID: 2231712 25. Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. GenBank. Nucleic Acids Res. 2016; 44 (D1):D67–72. PubMed Central PMCID: PMCPMC4702903. https://doi.org/10.1093/nar/gkv1276 PMID: 26590407 26. Johannes CB, Le TK, Zhou X, Johnston JA, Dworkin RH. The prevalence of chronic pain in United States adults: results of an Internet-based survey. J Pain. 2010; 11(11):1230–9. https://doi.org/10. 1016/j.jpain.2010.07.002 PMID: 20797916 27. Parker SL, Mendenhall SK, Godil SS, Sivasubramanian P, Cahill K, Ziewacz J, et al. Incidence of Low Back Pain After Lumbar Discectomy for Herniated Disc and Its Effect on Patient-reported Outcomes. Clin Orthop Relat Res. 2015; 473(6):1988–99. PubMed Central PMCID: PMCPMC4419014. https://doi. org/10.1007/s11999-015-4193-1 PMID: 25694267 28. Shifflett GD, Bjerke-Kroll BT, Nwachukwu BU, Kueper J, Burket J, Sama AA, et al. Microbiologic profile of infections in presumed aseptic revision spine surgery. Eur Spine J. 2016; 25(12):3902–7. https://doi. org/10.1007/s00586-016-4539-8 PMID: 27026016 29. Gausden EB, Villa J, Warner SJ, Redko M, Pearle A, Miller A, et al. Nonunion after clavicle osteosynth- esis: High incidence of Propionibacterium acnes. J Orthop Trauma. 2016. 30. Gaillard C, Dupond M, Brisou P, Gaillard T. Septic nonunions of lower limb long bones: don’t neglect Propionibacterium acnes! Int J Low Extrem Wounds. 2013; 12(4):301–5. https://doi.org/10.1177/ 1534734613489990 PMID: 24043669 31. Singh JA, Sperling JW, Schleck C, Harmsen WS, Cofield RH. Periprosthetic infections after total shoul- der arthroplasty: a 33-year perspective. J Shoulder Elbow Surg. 2012; 21(11):1534–41. PubMed Cen- tral PMCID: PMCPMC3586318. https://doi.org/10.1016/j.jse.2012.01.006 PMID: 22516570 32. Holmberg A, Lood R, Morgelin M, Soderquist B, Holst E, Collin M, et al. Biofilm formation by Propioni- bacterium acnes is a characteristic of invasive isolates. Clin Microbiol Infect. 2009; 15(8):787–95. https://doi.org/10.1111/j.1469-0691.2009.02747.x PMID: 19392888 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 16 / 17 33. Lutz JA, Otten P, Maestretti G. Late infections after dynamic stabilization of the lumbar spine with Dynesys. Eur Spine J. 2012; 21(12):2573–9. PubMed Central PMCID: PMCPMC3508231. https://doi. org/10.1007/s00586-012-2366-0 PMID: 22610441 34. Jakab E, Zbinden R, Gubler J, Ruef C, von Graevenitz A, Krause M. Severe infections caused by Pro- pionibacterium acnes: an underestimated pathogen in late postoperative infections. Yale J Biol Med. 1996; 69(6):477–82.PubMed Central PMCID: PMCPMC2589039. PMID: 9436290 35. Amital H, Govoni M, Maya R, Meroni PL, Ori B, Shoenfeld Y, et al. Role of infectious agents in systemic rheumatic diseases. Clin Exp Rheumatol. 2008; 26(1 Suppl 48):S27–32. 36. Zimmermann P, Curtis N. Synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO) syndrome— A challenging diagnosis not to be missed. J Infect. 2016; 72 Suppl:S106–14. 37. Carneiro S, Sampaio-Barros PD. SAPHO syndrome. Rheum Dis Clin North Am. 2013; 39(2):401–18. https://doi.org/10.1016/j.rdc.2013.02.009 PMID: 23597971 38. Omori M, Bito T, Yamada M, Ogura K, Eishi Y, Nishigori C. Systemic sarcoidosis with bone marrow involvement showing Propionibacterium acnes in the lymph nodes. J Eur Acad Dermatol Venereol. 2015; 29(10):2059–60. https://doi.org/10.1111/jdv.12594 PMID: 24909186 39. Zhou Y, Hu Y, Li H. Role of Propionibacterium Acnes in Sarcoidosis: A Meta-analysis. Sarcoidosis Vasc Diffuse Lung Dis. 2013; 30(4):262–7. PMID: 24351617 40. Satoh F, Morita H, Tayama H, Inoue Y, Eishi Y, Yoshimura A. Renal sarcoidosis with limited lung mani- festations expressing Propionibacterium acnes antigens in the affected tubulointerstitium. Am J Med Sci. 2013; 346(3):250–2. https://doi.org/10.1097/MAJ.0b013e31828bdf9f PMID: 23531993 41. Eishi Y. Etiologic aspect of sarcoidosis as an allergic endogenous infection caused by Propionibacter- ium acnes. Biomed Res Int. 2013; 2013:935289. PubMed Central PMCID: PMCPMC3697284. https:// doi.org/10.1155/2013/935289 PMID: 23844371 42. Asahina A, Miura K, Saito I, Oshikata C, Ishii N, Eishi Y. Cutaneous sarcoidosis with livedoid lesions: evidence of the involvement of Propionibacterium acnes. J Dermatol. 2013; 40(6):501–2. https://doi. org/10.1111/1346-8138.12120 PMID: 23731481 43. Bae Y, Ito T, Iida T, Uchida K, Sekine M, Nakajima Y, et al. Intracellular Propionibacterium acnes infec- tion in glandular epithelium and stromal macrophages of the prostate with or without cancer. PLoS One. 2014; 9(2):e90324. PubMed Central PMCID: PMCPMC3938683. https://doi.org/10.1371/journal.pone. 0090324 PMID: 24587325 44. Fischer N, Mak TN, Shinohara DB, Sfanos KS, Meyer TF, Bruggemann H. Deciphering the intracellular fate of Propionibacterium acnes in macrophages. Biomed Res Int. 2013; 2013:603046. PubMed Central PMCID: PMCPMC3687600. https://doi.org/10.1155/2013/603046 PMID: 23862148 Propionibacterium acnes biofilm in intervertebral discs of patients undergoing microdiscectomy PLOS ONE | https://doi.org/10.1371/journal.pone.0174518 April 3, 2017 17 / 17