Evidence for strain-specific immunity to 
pneumonia in bighorn sheep
Authors: E. Frances Cassirer, Kezia R. Manlove, 
Raina L. Plowright, and Thomas E. Besser
This is the peer reviewed version of the following article: citation below, which has been published 
in final form in Journal of Wildlife Management at https://dx.doi.org/10.1002/jwmg.21172. This 
article may be used for non-commercial purposes in accordance with Wiley Terms and Conditions 
for Self-Archiving.
Cassirer, E. Frances, Kezia R. Manlove, Raina K. Plowright, and Thomas E. Besser. "Evidence 
for strain-specific immunity to pneumonia in bighorn sheep." Journal of Wildlife Management 81, 
no. 1 (January 2017): 133-143. DOI: 10.1002/jwmg.21172.
Made available through Montana State University’s ScholarWorks 
scholarworks.montana.edu 
Evidence for Strain-Specific Immunity to 
Pneumonia in Bighorn Sheep
E. FRANCES CASSIRER,1 Idaho Department of Fish and Game, 3316 16th Street, Lewiston, ID 83501, USA
KEZIA R. MANLOVE, Center for Infectious Disease Dynamics, Pennsylvania State University, University Park, PA 16802, USA
RAINA K. PLOWRIGHT, Department of Microbiology and Immunology, Montana State University, Bozeman, MT 59717, USA
THOMAS E. BESSER, Department of Veterinary Microbiology and Pathology and Washington Animal Disease Diagnostic Laboratory,
Washington State University, Pullman, WA 99164, USA
ABSTRACT Transmission of pathogens commonly carried by domestic sheep and goats poses a serious
threat to bighorn sheep (Ovis canadensis) populations. All-age pneumonia die-offs usually ensue, followed by
asymptomatic carriage of Mycoplasma ovipneumoniae by some of the survivors. Lambs born into these
chronically infected populations often succumb to pneumonia, but adults are usually healthy. Surprisingly, we
found that introduction of a new genotype (strain) of M. ovipneumoniae into a chronically infected bighorn
sheep population in the Hells Canyon region of Washington and Oregon was accompanied by adult
morbidity (100%) and pneumonia-induced mortality (33%) similar to that reported in epizootics following
exposure of na€ıve bighorn sheep. This suggests an immune mismatch occurred that led to ineffective cross-
strain protection. To understand the broader context surrounding this event, we conducted a retrospective
analysis ofM. ovipneumoniae strains detected in 14 interconnected populations in Hells Canyon over nearly 3
decades. We used multi-locus sequence typing of DNA extracts from 123 upper respiratory tract and fresh,
frozen, and formalin-fixed lung samples to identify 5 distinct strains ofM. ovipneumoniae associated with all-
age disease outbreaks between 1986 and 2014, a pattern consistent with repeated transmission events
(spillover) from reservoir hosts. Phylogenetic analysis showed that the strain associated with the outbreak
observed in this study was likely of domestic goat origin, whereas strains from other recent disease outbreaks
probably originated in domestic sheep. Some strains persisted and spread across populations, whereas others
faded out or were replaced. Lack of cross-strain immunity in the face of recurrent spillovers from reservoir
hosts may account for a significant proportion of the disease outbreaks in bighorn sheep that continue to
happen regularly despite a century of exposure to domestic sheep and goats. Strain-specific immunity could
also complicate efforts to develop vaccines. The results of our study support existing management direction to
prevent contacts that could lead to pathogen transmission from domestic small ruminants to wild sheep, even
if the wild sheep have previously been exposed. Our data also show that under current management, spillover
is continuing to occur, suggesting that enhanced efforts are indicated to avoid introducing new strains of
M. ovipneumoniae into wild sheep populations. We recommend looking for new management approaches,
such as clearing M. ovipneumoniae infection from domestic animal reservoirs in bighorn sheep range, and
placing greater emphasis on existing strategies to elicit more active cooperation by the public and to increase
vigilance on the part of resource managers. 
 2016 The Wildlife Society.
KEY WORDS bighorn sheep, disease ecology, Hells Canyon, livestock-wildlife interface, molecular epidemiology,
multi-locus sequence typing, Mycoplasma ovipneumoniae, Ovis canadensis.
Pneumonia in bighorn sheep (Ovis canadensis) is a
population-limiting disease associated with transmission of
pathogens from domestic sheep and goats (Foreyt and Jessup
1982, Besser et al. 2013, Cassirer et al. 2013). As with many
other wildlife diseases, a lack of comprehensive, system-
specific information hampers disease management (Besser
et al. 2013, Joseph et al. 2013). Limiting contact with
domestic sheep and goats is the primary strategy for
preventing disease emergence in bighorn sheep (Western
Association of Fish and Wildife Agencies Wild Sheep
Working Group 2012, The Wildlife Society 2015).
Although currently the best management option available,
implementation is politically and logistically difficult because
of the natural movements of wild animals, unregulated
presence of domestic sheep and goats on private lands, and
concerns by the livestock industry about losing access to
public grazing allotments. Reliable knowledge about health
threats and potential solutions will help wildlife and land
managers make appropriate risk management decisions that
will succeed in resolving the problem of pneumonia in
bighorn sheep.
Based on the hypothesis that Mannheimia haemolytica
expressing leukotoxin is the key causal pathogen, researchers
have tested numerous vaccines to boost immunity to disease
in bighorn sheep. However, so far no vaccine has protected
wild sheep commingled with domestic sheep or goats in
captive settings or shown potential for efficacy in free-
ranging animals (Callan et al. 1991, Kraabel et al. 1998,
Cassirer et al. 2001, Subramaniam et al. 2011, Sirochman
et al. 2012). There may be several reasons for the elusiveness
of an effective vaccine. First, there is a basic question as to
the role of M. haemolytica in the disease (Besser et al. 2013)
and second there are significant technical difficulties
associated with vaccine development and application.
Experimental challenge with leukotoxin-positive M. hae-
molytica, a well-described respiratory pathogen in domestic
ruminants, is lethal to bighorn sheep in captivity (Foreyt
et al. 1994, Dassanayake et al. 2009). However, M.
haemolytica is only weakly associated with pneumonia
epizootics in free-ranging bighorn sheep populations
(Besser et al. 2012b). The pathology, microbiology, and
the course of disease experimentally induced with M.
haemolytica also do not match observations from the field
(Besser et al. 2014). Recently, application of sensitive
molecular diagnostic techniques on high quality samples led
to identification of Mycoplasma ovipneumoniae, a previously
overlooked bacterium, as the pathogen most strongly
supported as a primary causal agent of pneumonia in
bighorn sheep (Besser et al. 2008, 2012a, b).
M. ovipneumoniae is host-specific to Caprinae, and is
frequently carried asymptomatically by domestic sheep and
goats (Martin and Aitken 2000). When introduced into
na€ıve bighorn sheep populations, outbreaks of polymicrobial
pneumonia ensue, sometimes resulting in high mortality in
all age classes (Besser et al. 2008, 2014). After all-age
pneumonia outbreaks, surviving adults usually maintain
good health and normal life spans, although some individuals
chronically carryM. ovipneumoniae in their upper respiratory
tract (Besser et al. 2013). Both carriers and non-carriers are
resistant to disease although this protection fails to prevent
epizootics in lambs (Plowright et al. 2013, Manlove et al.
2016).
M. ovipneumoniae is also associated with mild and transient
respiratory disease, usually in juveniles, in its normal
domestic sheep and goat hosts (DaMassa et al. 1992, Martin
and Aitken 2000). However, several investigators have
reported thatM. ovipneumoniae infections in domestic sheep
and goats can cause severe pneumonia, particularly when
multiple strains are present (Parham et al. 2006, Rifatbegovic
et al. 2011). This could be linked to a strain-specific immune
response that fails to provide universal protection. Many
pathogens are able to evade host immune responses by
expressing a diversity of surface-exposed targets for
neutralizing antibodies. From influenza virus to Mycoplasma
spp., antigenic variation within and across strains enables
immune escape by pathogens and also complicates develop-
ment of vaccines (Citti et al. 2010, Vink et al. 2012,
Qui~nones-Parra et al. 2014).
We documented the effects of invasion of a novel strain of
M. ovipneumoniae into a group of free-ranging bighorn sheep
that had harbored adult carriers for nearly 20 years following
an all-age pneumonia outbreak (Cassirer et al. 1996,
Plowright et al. 2013). Our expectation was that these
adults were immune to the pathogen and that invasion of a
new strain would not cause disease.
STUDY AREA
We conducted this study near Heller Bar at the mouth of the
Grande Ronde River in Asotin County, Washington, USA
(46.0798N, 116.9868 W). The area was located in low
elevation (250–1,250m) canyon grasslands and cliffs along
the breaks of the Grande Ronde and Snake Rivers on the
northern edge of Hells Canyon. Summers were hot (x highs
in Jul and Aug¼ 26–328C) and winters were mild (x lows in
Dec and Jan¼2 to 28C). Average annual precipitation was
31 cm. July and August were the driest months and peak
precipitation occurred in May. Plant associations were
dominated by perennial bunchgrass (Pseudoroegneria spicata
and Festuca idahoensis) communities, with deciduous riparian
shrub stringers and upland shrub-fields. Douglas-fir (Pseu-
dotsuga menziesii) and ponderosa pine (Pinus ponderosa)
stands occurred on northerly aspects. In addition to bighorn
sheep, common ungulates in the study area included mule
deer (Odocoileus hemionus), white-tailed deer (O. virginianus),
and elk (Cervus elaphus). Potential predators of bighorn
sheep included cougars (Felis concolor), bobcats (Lynx rufus),
coyotes (Canis latrans), wolves (C. lupus), and black bears
(Ursus americanus). Over 50% of the area was publicly owned
andmanaged by federal and state agencies chiefly for wildlife,
recreation, and seasonal (spring) cattle grazing. A low
density, unincorporated rural community was scattered on
adjoining private rangelands at the mouth of the Grande
Ronde River and along the adjacent Snake River.
Following extirpation in the early 1900s, the Washington
Department of Fish and Wildlife reintroduced bighorn
sheep to the Joseph Creek Wildlife Area near Heller Bar.
Between 1977 and 1989, 39 sheep were translocated from
Washington, Oregon, and Montana to establish the Black
Butte population (Johnson 1995). This became one of 16
interconnected populations that comprise the Hells Canyon
bighorn sheep metapopulation. The Black Butte population
increased to approximately 215 animals before a pneumonia
outbreak occurred in 1995; 70% of the sheep died or were
transferred to captivity in an attempt to stop the epidemic
(Cassirer et al. 1996). The source of the outbreak was
thought to be domestic sheep or goats on private lands within
the Black Butte bighorn sheep population range (Rudolph
et al. 2003). The population never recovered because of
chronically low recruitment due to pneumonia-induced
mortality in lambs (Plowright et al. 2013). By 2013, only 36
bighorn sheep were observed in surveys, and the population
was estimated at 45 (Cassirer et al. 2013, Washington
Department of Fish and Wildlife, unpublished data). Three
spatially distinct female groups occur in the population:
Heller Bar, Shumaker, and Joseph Canyon. The groups are
connected by movements of males, but we observed no
female interactions across groups during this study. The
Heller Bar female group was most accessible from the road
and was the subject of this investigation.
METHODS
Observations
Wemonitored the Heller Bar female group during 2013 and
2014 as part of a study of contact patterns and lamb survival.
We could individually identify 4 (31%) and 11 (85%) of the
13 adult females in 2013 and 2014, respectively, by
numbered ear tags and color-coded and numbered very
high frequency (VHF) radio-collars. One unmarked female
was missing a horn, so all 13 sheep were individually
identifiable in 2014. We located marked animals from the
ground by radio-telemetry and then observed them through
binoculars and a spotting scope. We conducted frequent and
intensive observations between 1 May and 16 July to
document productivity and neonatal survival (2013 median
observation interval¼ 4 days, median duration of each
observation¼ 3 hr; 2014 median observation interval¼ 1.5
days, median duration¼ 2 hr). Frequency of observation
from 17 July through 26 August was every 10 days in 2013
and every 5 days in 2014, and from 26 August through the
first week in October we observed the sheep once a month in
2013 and every 10 days in 2014. Median duration of
observations from 17 July through October was 1 hour in
both years. At each observation we recorded female and
lamb health and behavior. Animals observed with nasal
discharge, droopy ears, head shaking, or lethargy received a
clinical score of 1, and animals observed coughing received a
clinical score of 2. Sheep with no evidence of disease
received a clinical score of 0.
Radio-collars on adults were equipped with a switch that
triggered a fast pulse mortality signal if no movement was
detected for 4 hours. We conducted site investigations, and
where possible, retrieved carcasses whole when mortalities
were detected. Where this was not possible, we conducted
field necropsies and collected the head, the respiratory tract,
and grossly abnormal tissues when available. We detected
lamb mortalities through observation and retrieved whole
dead lambs when autolysis was not too advanced for
diagnostic testing (Cassirer and Sinclair 2007). We assigned
lamb mortality dates as the midpoint between the last live
observation and either the date when the carcass was found,
or the date when the dam was first observed without a lamb if
no carcass was located. We assumed a female had lost her
lamb when it was found dead or when the number of lambs
declined and she was never again observed with a lamb that
year. All cadavers and tissues were submitted to the
Washington Animal Disease and Diagnostic Laboratory
(WADDL; Pullman, WA, USA) for analysis.
Health Sampling
We captured and sampled females in February (n¼ 11 of 13)
and July (n¼ 2 of 11) 2014. In October 2014, we resampled
all 8 remaining sheep when we transferred them to captivity.
We conducted captures via helicopter netgun and by darting
from the ground with chemical immobilizing agents. All
capture and handling followed animal care protocols
approved by the Washington Department of Fish and
Wildlife. Sampling entailed collecting throat swabs and
placing them in buffered glycerol or Port-a-cul transport
media (Becton, Dickinson, and Company, Franklin Lakes,
NJ, USA, #220144, #221606) for aerobic culture to detect
Pasteurellaceae, swabbing nasal passages and placing swabs
in mycoplasma broth (#102, Hardy Diagnostics, Santa
Maria, CA, USA) for culture enrichment and polymerase
chain reaction (PCR) detection of M. ovipneumoniae
(Ziegler et al. 2014), and collection of serum for detection
of antibodies to M. ovipneumoniae (competitive enzyme-
linked immunosorbent assay [ELISA]), bovine respiratory
syncytial virus (virus neutralization [VN]), bovine virus
diarrhea (VN), infectious bovine rhinotracheitis (VN), and
bovine parainfluenza-3 (PI-3, VN). Diagnostic testing on
the above samples was conducted by WADDL.
We also collected upper respiratory washes by flushing
nasal passages with 50ml of phosphate-buffered saline and
swabbed the oropharynx. We kept samples cool and
processed them within 48 hours of collection, or stored
them at 208C. We extracted DNA (DNeasy, Qiagen,
Redwood City, CA, USA) from swabs, from 10-ml aliquots
of nasal wash, and from lung tissues of animals that died
during the study as well as 2 pneumonic lambs that died in
adjacent populations in 2013 to test for presence of
pneumonia agents. We used a multiplex PCR to detect
Pasteurellaceae including Bibersteinia trehalosi, Pasteurella
multocida, and Mannheimia spp. (Besser et al. 2012b) and
performed PCR for lktA, the gene encoding leukotoxin A,
the major virulence factor of Mannheimia spp. and B.
trehalosi (Walsh et al. 2016). If an agent was detected by
either PCR or culture on any sample, we classified the animal
as positive for that agent.
Strain Typing
Health of the Hells Canyon bighorn sheep metapopulation
has been intensively monitored since the 1995 pneumonia
outbreak in the Black Butte population, and intermittently
prior to this. Therefore, we had access to fixed, frozen, and
fresh lung tissue and swab samples collected from 1995–2015
in the Heller Bar female group and from 1986–2015 in
adjacent female groups and populations. We extracted DNA
from a subset of these sources to detect and strain type
M. ovipneumoniae within the study population and the
metapopulation through time. Detection was based on
conventional (McAuliffe et al. 2003) and realtime (Ziegler
et al. 2014) PCR.
We used multi-locus sequence typing (MLST) to
characterize strains using partial DNA sequences of the
16S-23S intergenic spacer region (IGS), the small ribosomal
subunit (16S), and the genes encoding RNA polymerase B
(rpoB) and gyrase B (gyrB). We amplified these targets with
PCR using a suite of existing and newly developed primers
(Table 1). Because of the high degree of DNA sequence
variation in M. ovipneumoniae, the biggest challenge in
developing this ensemble of loci was identification of targets
with sufficiently conserved primer binding site sequences to
enable consistent PCR amplification for subsequent se-
quencing. The loci selected for this study each exhibited
extensive sequence polymorphism and together provide a
highly discriminatory test. We typed the concatenated
sequences using multi-locus sequence analysis because of the
large numbers and diversity of the alleles detected at each
target locus. We aligned sequences using Clustal Omega
(http://www.ebi.ac.uk/Tools/msa/clustalo/, accessed 06 Sep
2016). We report sequence divergence as the percentage
non-identity.
All PCR protocols included a preliminary dissociation
phase (958C, 15min), amplification, and a final extension
phase (728C, 7min). We amplified the 16S target using 35
cycles of 30 seconds each of dissociation (958C), annealing
(588C), and extension (728C). We amplified the IGS target
using 35 cycles of dissociation (958C, 1min), annealing
(528C, 2min), and extension (728C, 2min). For nested IGS
amplification, the parameters for the external primers were
identical except that the annealing temperature was 548C.
For rpoB and gyrB, we used inner and nested reactions with
identical amplification conditions: dissociation (958C,
1min), annealing (508C, 1min), and extension (728C,
2min). We treated the extracts with alkaline phosphatase
and exonuclease I (FastAP and ExoI, ThermoFisher
Scientific, Waltham, MA, USA) according to the manu-
facturer’s instructions. We submitted extracts to Amplicon
Express (Pullman, WA, USA) to determine forward and
reverse DNA sequences using the same primers used for
PCR amplification. Representative sequences of all 4 target
loci for the gentoypes herein are available in Genbank:
strain 393 (KU986495, KU986500, KU986503, KU986506,
representing IGS,16S, rpoB, and gyrB), strain404 (KU986496,
KU986501, KU986504, KU986507), strain 415 (KU986494,
KU986499, KU986502, KU986505), strain 402 (KU986493,
KU986498, representing IGS and 16S), and strain 419
(KU986492, KU986497).
Statistical Analysis
We used a Kaplan–Meier staggered entry estimator and a
Cox proportional hazard model to analyze survival of females
and lambs. We fit trend lines to 7-day moving averages of
clinical scores using a lowess smoothing factor derived from
locally weighted moving mean scores spanning 25% of the
full dataset (2–3 weeks). We used a Fisher’s exact test to
analyze prevalence of pneumonia agents before, during, and
after the outbreak and to compare agents present in adult and
lambmortalities.We used a Kruskal–Wallis rank-sum test to
determine whether neutralizing titers to PI-3 differed before,
during, and after the outbreak. We used a 1-way analysis
of variance (ANOVA) and Tukey contrasts to test for
differences in serologic antibody titers to M. ovipneumoniae
over the course of the outbreak and a 2-sided t-test to
compare pre-outbreak antibody titers to M. ovipneumoniae
in animals that died and those that survived. We used a
Wilcoxon rank sum test with continuity correction to analyze
duration of clinical signs. We conducted analyses with
package survival (Therneau 2015), and stats and base
packages in R (R Core Team 2015).
RESULTS
Survival and Clinical Signs of Disease
In 2013, we observed all marked females with lambs, and
median parturition date was 18 May (range¼ 5–20 May). In
2014, we observed 10 of 13 females with live lambs and
median parturition date was 8 May (range¼ 27 Apr–17
May). One marked female and her lamb died, presumably of
dystocia, on 16 May 2014 (e5 and L5, Fig. 1a), 1 marked
female was observed with a dead 2-day old lamb (e10,
Fig. 1a), and 1 unmarked female appeared to be pregnant but
was never observed with a lamb (e22, Fig. 1a).
We observed clinical signs of pneumonia in lambs starting
1 June in 2013 and 26 May in 2014. Symptoms continued
until the day the last lamb died, which was 30 June in 2013,
and 2 July in 2014 (Fig. 1). Median lamb mortality date
was 28 June in 2013 and 24 June in 2014, at a median age
Table 1. Oligonucleotide primers for polymerase chain reactions (PCR) used to amplify Mycoplasma ovipneumoniae multi-locus sequence typing (MLST)
targets. Nesting refers to external and internal primer sets used for nested PCR reactions for amplification of the MLST loci, IGS, rpoB, and gyrB, when
amplification from the default (internal) primers produced insufficient DNA template for sequencing.
Targeta Nesting Oligonucleotide primer sequence Reference
LM-F TGAACGGAATATGTTAGCTT McAuliffe et al. (2003)
LM-R GACTTCATCCTGCACTCTGT McAuliffe et al. (2003)
Ex-IGS-F External GTTAACCTCGGAGACCATTG This paper
Ex-IGS-R External GTTTGCTAGGTTGGGTTTCC This paper
IGS-F Internal GGAACACCTCCTTTCTACGG Besser et al. (2012b)
IGS-R Internal CCAAGGCATCCACCAAATAC Besser et al. (2012b)
Ex- rpoB F External AGTTATCACAATTTATGGATCAAA This paper
Ex- rpoB R External GCTCAAAGTTCCATTTCNCCGAA This paper
rpoB F Internal TCGGCTTCAGCAATTCCTTTCTT This paper
rpoB R Internal TCGGCTGTTGGGTTGTCTTCTC This paper
Ex- gyrB F External AAAACGWCCAGGKATGTATATTGG This paper
Ex- gyrB R External GGATCCATTGTTGTTTCTCATAATTG This paper
gyrB F Internal GGGTCAAACAAAAGCAAAACTAAA This paper
gyrB R Internal ACGGAATAAAAATGTCAAAAGTAA This paper
a LM¼ small ribosomal subunit (16S) gene, IGS¼ 16S-23S intergenic spacer, rpoB¼b subunit of RNA polymerase gene, gyrB¼ gyrase B gene,
F¼Forward, R¼Reverse.
of 40 and 44 days, respectively. All lambs died both years
and there were no differences in lamb survival curves
between years (log rank1¼ 0.01, P¼ 0.92) or between 2014
and the previous 10 years (Fig. 1c). We submitted 11 lambs
for necropsy (6 in 2013 and 5 in 2014). With the exception
of 1 lamb that died at approximately 2 days of age in
2014 (L10, Fig. 1a), all lambs presented characteristic lesions
of bighorn lamb respiratory disease, including moderate to
Figure 1. Clinical signs of pneumonia and survival of bighorn sheep in the Black Butte, Washington population during summers 2013 (n¼ 4 adult F and 4
lambs) and 2014 (n¼ 13 adult F and 10 lambs). (a) Time series of field observations of pneumonia symptoms in adult females (e) and their lambs (L).
Observations ending prior to September indicate individual died. (b) Smoothed average daily clinical scores for adult females and lambs. (c) Adult female and
lamb survival betweenMay and October 2014 and survival betweenMay and October during the 10 previous years, 2004–2013 (Kaplan–Meier curves and 90%
CIs).
severe, subacute to chronic bronchopneumonia and otitis
media.
Median age at first observation of clinical signs in lambs
was 20 days (range: 7–35), median duration of clinical
signs was 22 days (range: 1–59), and median age at death
was 42 days (range: 22–66). Assuming that lambs were
infected by 4 days of age and lung lesions were present by
10 days of age (Besser et al. 2008), we estimated a median
latent period of 16 days (range: 3–31) between infection
and first observation of disease symptoms in lambs and a
median infection period of 38 days (range: 18–62) prior to
death.
In adults, the only evidence of possible respiratory disease
in 2013 was a single observation of coughing on 14 June, and
all adults survived. In 2014, we observed clinical signs of
pneumonia in adults starting in May. By June, all adults
exhibited symptoms of pneumonia including severe pro-
longed coughing (Fig. 1a and b). Five adult females (38%)
died between May and August 2014 (difference between
summers, log rank1¼ 5.98, P¼ 0.01) and the hazard of an
adult female dying in the summer of 2014 was 6.83 times
higher (SE¼ 0.83, P¼ 0.02) than in any of the previous 10
summers (2004–2013, Fig. 1c). We did not observe
pneumonia symptoms prior to the first adult death on 16
May 2014. Subsequent mortalities followed observation of
clinical signs of pneumonia and occurred on 26 June, 18 July,
27 July, and 3 August (Fig. 1a). Median duration of clinical
signs was 36 days (range¼ 18–81 days), which was longer
than observed in lambs (median¼ 22 days, range¼ 1–59,
W¼ 136.5, P< 0.001). Duration of clinical signs did not
differ between adults that died and those that survived
(Fig. 1a, Wilcoxon rank sum W¼ 20, P¼ 1.0). We
submitted samples to WADDL from all (4 of 5) mortalities
where sufficient tissues were available for diagnosis. No gross
or histological evidence of respiratory disease was found in
the female that died on 16 May, although evaluation of
tissues at WADDL was limited because of autolysis. The 3
adult females submitted for necropsy between late June
and early August were diagnosed with chronic, moderate to
severe bronchopneumonia. The survivors appeared to make
a full recovery with no evidence of ongoing disease.
Microbiology and Immune Responses
M. ovipneumoniae was the only pneumonia agent detected
more frequently in the lungs of adults that died of
pneumonia than in the upper respiratory tract of healthy
adults before and after the outbreak (x1
2¼ 26.66,
P< 0.001; Table 2). Prevalence of other suspected
pneumonia agents in the upper respiratory tract of
symptomatic adults sampled during the outbreak was
similar to that detected in the lungs of adults that died of
pneumonia except that Mannheimia spp. were detected in
the upper respiratory tract of live adults but not in the lungs
of adults that died. We found no differences in prevalence of
pneumonia agents present in upper respiratory tract samples
collected before and after the outbreak (x1
2< 2.6, P> 0.2)
or in the lungs of lambs that died in 2013 and 2014
(x1
2< 0.39, P> 0.5). Detection of Mannheimia spp. was
more common in lamb mortalities than in adult mortalities
(x1
2¼ 4.55, P¼ 0.07), and P. multocida was more frequently
detected in the lungs of dead adults than lambs (x1
2¼ 8.78,
P¼ 0.01; Table 2).
We detected serologic evidence of exposure to PI-3 (VN
titer 4) and M. ovipneumoniae (ELISA inhibition> 50%)
in adults before, during, and after the 2014 pneumonia
outbreak. We did not detect evidence of exposure to other
respiratory viruses during the study. Average M. ovipneu-
moniae ELISA percent inhibition (%I) values prior to
the outbreak (69%) increased significantly to 89%I and
82%I during and after the disease event, respectively
(F2,18¼ 4.811, P¼ 0.02; Fig. 2a). Individuals that died
during the outbreak had higherM. ovipneumoniae ELISA %
I values prior to the outbreak (x¼ 79%) than those that
survived (x¼ 59%, t7.5¼ 3.02, P¼ 0.02; Fig. 2b). Median
PI-3 titers of 256 (log2 7.7) did not change significantly over
the course of the outbreak (x22¼ 4.55, P¼ 0.23).
Strain Typing
We genotyped M. ovipneumoniae from all Heller Bar
bighorn sheep where it was detected in 2013 (n¼ 7) and
2014 (n¼ 11). We found a single strain in 2013 based on
identical DNA sequences of each of the 4 MLST loci,
and that strain was also detected in the first lamb to die
of pneumonia in 2014. All subsequent detections of
M. ovipneumoniae differed from the 2013 strain at 3
MLST loci. The IGS sequences differed by 32 single
nucleotide polymorphisms (SNP) and 3 base insertions
or deletions (indels, 8.7% divergent), rpoB by 16 SNP
(2.8% divergent) and gyrB by 16 SNP (4% divergent).
The 16S sequences did not differ between strains.
We report strain differences by IGS sequences because we
were unable to amplify rpoB and gyrB from DNA extracted
Table 2. Prevalence of Mannheimia spp. (Mh), Bibersteinia trehalosi (Bt), Pasteurella multocida (Pm), Pasteurellaceae leukotoxin encoding gene (LktA), and
Mycoplasma ovipneumoniae (Movi) in asymptomatic bighorn sheep females (F) sampled before and after a pneumonia outbreak, symptomatic females during
the outbreak, and in the lungs of pneumonic females that died in the Black Butte population and pneumonic lambs that died in Black Butte, (10) and
adjacent populations (2), Washington and Oregon, USA.
Agent
F before
(n¼ 11)
F during (symptomatic)
(n¼ 2)
F pneumonia mortalities
(n¼ 3)
Lamb pneumonia mortalities
(n¼ 12)
F after
(n¼ 8)
Mh 0.91 1.00 0.00 0.70 0.75
Bt 0.82 1.00 1.00 0.80 1.00
Pm 0.73 1.00 1.00 0.10 1.00
LktA 0.27 0.50 0.33 0.50 0.38
Movi 0.09 1.00 1.00 1.00 0.13
from formalin-fixed, paraffin-embedded lung tissues, the
only specimens available prior to 2006. Because each of
these strains differed by indels in IGS, the strains are
conveniently designated by their differing IGS lengths. The
2013 Black Butte strain, IGS 404, has been detected in this
population since the 1995 pneumonia outbreak (Fig. 3b).
The 2014 strain, IGS 393, had never previously been
detected in this population or any other bighorn sheep
population in Hells Canyon or elsewhere in the western
United States (among >700 other isolates that have been
IGS typed).
In October 2014, we removed survivors from the Heller
Bar female group in an attempt to prevent further spread of
this strain. Nonetheless, 1 month after the removal, we
detected the IGS 393 strain type in an adult male removed
from the town of Asotin, Washington and we detected it
again 4 months later in a 9-month-old lamb in the Shumaker
female group, located between the Joseph and Heller Bar
Figure 3. Spatiotemporal distribution of the 16S-23S intergenic spacer (IGS) genotypes of Mycoplasma ovipneumoniae in the Hells Canyon bighorn sheep
metapopulation inWashington, Oregon, and Idaho, USA in (a) 1986 and 1992 (b) 1995–2013; and (c) 2014–2015. Each colored marker represents one strain
type, pie charts display strain types within populations and are scaled by sample size. Pie charts containing>1 color indicate that 2 strain types were present in a
population during that time interval but not necessarily detected in the same year. Gray shaded polygons denote bighorn sheep populations: AS¼Asotin,
BB¼Black Butte, BC¼Big Canyon, BR¼Bear Creek, IM¼ Imnaha, LH¼Lower Hells Canyon, LM¼Lookout Mountain, MU¼Muir,
MV¼Mountain View, MY¼Myers Creek, RB¼Redbird, SM¼ Sheep Mountain, TU¼Tucannon, UO¼Upper Hells Canyon, Oregon, UI¼Upper
Hells Canyon Idaho.
Figure 2. Serologic titers (competitive enzyme-linked immunosorbent assay [ELISA]) to Mycoplasma ovipneumoniae in bighorn sheep in Black Butte,
Washington, February–October 2014. (a) Mean and 90% confidence intervals before, during, and after a pneumonia outbreak. (b) Antibody titer levels before
the outbreak in adults that survived (x¼ 59%) and those that died (x¼ 79%).
groups in the Black Butte population. Retrospective analysis
revealed that this strain was present in the lungs of a male
that died of pneumonia in the Joseph Creek group in
December 2013, representing the index case of disease
associated with the IGS 393 strain type. The IGS 393 strain
has not been detected in any surrounding populations, which
remain carriers of the original IGS 404 strain (Fig. 3c).
Two other strains were detected in specimens obtained
during or after disease outbreaks in other Hells Canyon
populations (Coggins 1988, Foreyt et al. 1990), and have not
been detected since. These samples were from the Lostine
population in 1986–1987 (IGS 419) and theMountain View
population in 1992 (IGS 402; Fig. 3a). A third strain (IGS
415) associated with a pneumonia outbreak in the Sheep
Mountain population in 2000 was apparently replaced by
the IGS 404 strain by 2006 based on samples typed from
2006 and 2015 in that population. The IGS 415 strain was
subsequently infrequently detected in 4 other populations
between 2003 and 2009 and has not been found since then
(Fig. 3b).
Sequence divergence among the 3 recently detected strains
where all 4 genes could be analyzed (i.e., IGS 393, 404, and
415) was between 9% and 10%. These strains were well
dispersed across 20 genotypes ofM. ovipneumoniae collected
from 9 domestic sheep flocks in the western United States
and Australia and 10 domestic goat flocks in the western
United States and China. The IGS 404 and 415 types, first
identified in the Black Butte and Sheep Mountain
populations, respectively, were more closely related to the
domestic sheep lineage, whereas the IGS 393 type detected
in the Black Butte population in 2013 and 2014 clustered
with the domestic goat clade (Fig. 4).
DISCUSSION
This is the first study to report on an all-age pneumonia
outbreak in an intensively sampled population of free-
ranging bighorn sheep with health, survival, and observa-
tional data collected before, during, and after the disease
event. The collection and analysis of this information,
employing recently developed molecular methods for
pathogen detection and genotyping, allowed us to attribute
severe disease in a bighorn sheep population with long-
standing M. ovipneumoniae carriage to introduction of a
novel strain of M. ovipneumoniae. This conclusion is
supported by the detection of the never before recorded
IGS 393 strain in the pneumonic lungs of adults that died,
and in the upper respiratory tract of adults with clinical signs
during the outbreak. We also observed a significant increase
in antibody titers to M. ovipneumoniae during the outbreak
denoting an active immune challenge and we documented
that previous exposure and ongoing carriage of the M.
ovipneumoniae IGS 404 strain was not protective against
disease. To the contrary, lower survival of adults with higher
serologic titers prior to the disease outbreak could reflect a
harmful autoimmune reaction associated with antibody
response to M. ovipneumoniae in bighorn sheep as has been
suggested for domestic sheep (Niang et al. 1998a). Strain-
specific immunity, as measured by serologic antibody
inhibition of M. ovipneumoniae, was similarly reported by
Alley et al. (1999) for domestic sheep.
Adult mortality associated with this strain introduction was
within the range previously observed during pneumonia
outbreaks in na€ıve animals in this metapopulation (28–42%;
Cassirer et al. 2013). Lamb mortality followed an identical
time course regardless of strain, consistent with a lack of
Figure 4. Phylogeny of 3 bighorn sheep strains of Mycoplasma ovipneu-
moniae, Hells Canyon, Washington, Oregon, and Idaho, USA, and
randomly selected strains from domestic sheep (triangles) and domestic
goats (squares), 1975–2015. Domestic sheep and goats appear to host
divergent lineages ofM. ovipneumoniae and the samples from bighorn sheep
clustered with either the domestic sheep or domestic goat lineages.
Neighbor-joining tree of concatenated partial 16S, 16S-23S intergenic
spacer region (IGS), rpoB, and gyrB DNA sequences is rooted with
homologous sequences fromM. hyopneumoniae. Branch lengths are scaled by
proportion non-identity (scale bar). Domestic sheep samples are from
Washington, Oregon, Idaho, Nevada, Colorado, California, and an ATCC
type strain from Australia. Domestic goat samples are from Washington,
Idaho, California, and China (Yang et al. 2011, 2014).
protective immunity in neonates. The timing of the onset of
clinical signs following infection in lambs (latent period) was
similar to that reported in experimental challenge of adults
(Besser et al. 2014). However, disease progression in lambs
was more rapid and severe than observed in free-ranging
adults in this study or in experimental exposure of na€ıve
adults in captivity (Besser et al. 2014).
Although pneumonia in bighorn sheep is a polymicrobial
disease, pathogens other than M. ovipneumoniae, including
lktA positive Pasteurellaceae and respiratory viruses, were
either not detected or showed no association with disease.
Whereas M. ovipneumoniae was present in all pneumonic
adults and lambs, prevalence of Pasteurellaceae varied between
age classes. This could be due to conditions associated with
growth of an opportunistic pathogen or to other factors.
Sample sizes were too small to draw broader inference.
Anaerobic bacteria, not tested in this study, are a large
component of the microbiome in pneumonic bighorn sheep
lung tissue and may also play a larger role as secondary
pathogens than previously suspected (Besser et al. 2008).
The novel strain ofM. ovipneumoniae detected in this study
differed from the resident strain by 52 independent genetic
mutations on 4 loci. This unique strain was not a variant of a
resident strain and had never before been detected in over
700 samples strain-typed from Hells Canyon and other
bighorn sheep populations. Therefore, the most likely source
of this Caprinae-specific pathogen was a domestic sheep or
goat. Phlyogenetic analysis indicated that this strain was
most likely of domestic goat origin.
This strain introduction likely occurred from a domestic
goat on or from private lands within bighorn sheep range
despite substantial efforts by wildlife managers and
nongovernmental organizations to prevent contact. Man-
agement strategies included distributing educational material
to flock owners and the general public, purchasing and
removing a domestic sheep flock, and removing individual
bighorn or domestic sheep and goats when they were at risk
of contact. Our retrospective analysis showed that unique
strains of M. ovipneumoniae were associated with 4 other
epidemiologically unrelated all-age pneumonia outbreaks in
Hells Canyon, as would be expected from similar spillover
events. Two of these historical strains (IGS 402 and 419)
apparently remained localized, one spread and subsequently
disappeared (IGS 415), whereas the fourth (IGS 404) has
persisted and proliferated over a span of 20 years. It is not
clear why some strains of M. ovipneumoniae persist and
others apparently do not. The IGS 404 strain may have
driven fade-out of other extant strains when it spread, as
introduction of the IGS 393 strain did in this study. Strain
replacement might occur when the carrier host immune
response is cross-reactive but protection is strain-specific.
Under these conditions a new strain could have a competitive
advantage and exclude the original strain.
Although evidence suggests that this epizootic was caused
by introduction of a novel M. ovipneumoniae strain, it is also
possible that pneumonia outbreaks could be precipitated in
carrier bighorn sheep populations if appropriate mutations
occur in strains to which resistance has previously been
acquired. Mutations in key virulence genes or in genes
coding for the M. ovipneumoniae capsule, which likely
plays a role in adherence to host cells and in evading
antibody recognition (Niang et al. 1998b, Razin et al. 1998),
could cause disease and are unlikely to be detected by our
strain-typing method. Another plausible mechanism of
pneumonia resurgence would be reintroduction of the
same strain ofM. ovipneumoniae into a population following
either pathogen fade-out and waning immunity (Syden-
stricker et al. 2005) or recruitment of unexposed susceptible
individuals. Finally, other factors may play a role in
triggering outbreaks such as pathogen dose, host contact
patterns, immunocompetence, and invasion of secondary
pathogens. Identifying the conditions most frequently
associated with pneumonia outbreaks in previously exposed
populations and a wider investigation of the genetic diversity
and host-specificity of M. ovipneumoniae strains would
provide valuable insights into the adaptive immune response
in bighorn sheep and the ecology of this disease.
MANAGEMENT IMPLICATIONS
Lack of cross-strain immunity toM. ovipneumoniae could be
one explanation for the regular occurrence of pneumonia
epizootics in bighorn sheep populations over a century after
initial contact with domestic sheep. Single strain infection in
bighorn sheep populations contrasts with M. ovipneumoniae
carriage in domestic sheep where numerous strains typically
coexist within a flock (Alley et al. 1999, Harvey et al. 2007).
In the absence of cross-strain immunity, these flocks may
serve as a constant source of novel strains capable of causing
disease in bighorn sheep. Although vaccination could
potentially reduce pathogen burden or prevalence within
bighorn sheep populations, it is not clear that a vaccine would
protect bighorn sheep from severe disease if exposed to new
strains. Our results instead support preventing spillover as
a primary strategy for managing disease in bighorn sheep.
This could be accomplished by maintaining separation
between bighorn sheep and domestic sheep and goats, by
clearing M. ovipneumoniae infection from domestic hosts,
and by exercising caution to avoid mixing M. ovipneumoniae
strains among bighorn sheep populations during trans-
locations. The management strategies implemented near the
bighorn sheep in this study were apparently unsuccessful
in preventing transmission, underscoring the difficulty
of maintaining separation. New approaches, more active
cooperation by the public, and greater vigilance on the part
of resource managers may be key to preventing pneumonia
outbreaks in bighorn sheep.
ACKNOWLEDGMENTS
We thank N. L. Fortin, M. D. Lerch, C. L. Lowe, J. R.
Ohm, and P. A. Wik for assistance in the field and K. Baker
for laboratory assistance. F. Yang provided unpublished
sequence data for the MLST loci in Chinese goat strain
TC1. Funding was provided by the Idaho Department of
Fish and Game, Washington Department of Fish and
Wildlife, Shikar-Safari Club International, Idaho Wildlife
Disease Research Oversight Committee, Morris Animal
Foundation grant D13ZO-081, and Federal Aid to Wildlife
Restoration. RKP was supported by National Institutes
of Health IDeA Program grants P20GM103474 and
P30GM110732, P. Thye, and Montana University System
Research Initiative: 51040-MUSRI2015-03.
LITERATURE CITED
Alley, M. R., G. Ionas, and J. K. Clarke. 1999. Chronic non-progressive
pneumonia of sheep in New Zealand—a review of the role ofMycoplasma
ovipneumoniae. New Zealand Veterinary Journal 47:155–160.
Besser, T. E., E. F. Cassirer, M. A. Highland, P. Wolff, A. Justice-Allen,
K. M. Mansfield, M. A. Davis, and W. J. Foreyt. 2013. Bighorn sheep
pneumonia: sorting out the etiology of a polymicrobial disease. Journal of
Preventive Veterinary Medicine 108:85–93.
Besser, T. E., E. F. Cassirer, K. A. Potter, K. Lahmers, J. L. Oaks, S.
Shanthalingam, S. Srikumaran, and W. J. Foreyt. 2014. Epizootic
pneumonia of bighorn sheep following experimental exposure to
Mycoplasma ovipneumoniae. PLoS ONE 9:e110039.
Besser, T. E., E. F. Cassirer, K. A. Potter, J. VanderSchalie, A. Fischer, D. P.
Knowles, D. R. Herndon, F. R. Rurangirwa, G. C. Weiser, and S.
Srikumaran. 2008. Association of Mycoplasma ovipneumoniae infection
with population-limiting respiratory disease in free-ranging Rocky
Mountain bighorn sheep (Ovis canadensis canadensis). Journal of Clinical
Microbiology 46:423–430.
Besser, T. E., E. F. Cassirer, C. Yamada, K. A. Potter, C. N.Herndon,W. J.
Foreyt, D. P. Knowles, and S. Srikumaran. 2012a. Survival of bighorn
sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in
the absence of Mycoplasma ovipneumoniae. Journal of Wildlife Disease
48:168–172.
Besser, T. E., M. Highland, K. Baker, E. F. Cassirer, N. J. Anderson, J. M.
Ramsey, K. M. Mansfield, D. Bruning, P. Wolff, J. B. Smith, and J. A.
Jenks. 2012b. Causes of pneumonia epizootics among bighorn sheep,
western United States, 2008–2010. Emerging Infectious Disease 18:406–
413.
Callan, R. J., T. D. Bunch, G. W. Workman, and R. E. Mock. 1991.
Development of pneumonia in desert bighorn sheep after exposure to a
flock of exotic wild and domestic sheep. Journal of the American
Veterinary Association 198:1052–1055.
Cassirer, E. F., L. E. Oldenburg, V. L. Coggins, P. Fowler, K. M. Rudolph,
D. L. Hunter, and W. J. Foreyt. 1996. Overview and preliminary analysis
of a bighorn sheep dieoff, Hells Canyon 1995–96. Biennial Symposium
Northern Wild Sheep and Goat Council 10:78–86.
Cassirer, E. F., R. K. Plowright, K. R. Manlove, P. C. Cross, A. P. Dobson,
K. A. Potter, and P. J. Hudson. 2013. Spatio-temporal dynamics of
pneumonia in bighorn sheep (Ovis canadensis). Journal of Animal Ecology
82:518–528.
Cassirer, E. F., K.M. Rudolph, P. Fowler, V. L. Coggins, D. L.Hunter, and
M. W. Miller. 2001. Evaluation of female vaccination as a tool for
increasing bighorn lamb survival following pasteurellosis epizootics.
Journal of Wildlife Diseases 37:49–57.
Cassirer, E. F., and A. R. E. Sinclair. 2007. Dynamics of pneumonia in a
bighorn sheepmetapopulation. Journal ofWildlifeManagement 71:1080–
1088.
Citti, C., L. X. Nouvel, and E. Baranowski. 2010. Phase and antigenic
variation in mycoplasmas. Future Microbiology 5:1073–1085.
Coggins, V. L. 1988. The Lostine Rocky Mountain bighorn sheep die-off
and domestic sheep. Biennial Symposium Northern Wild Sheep 6:57–64.
DaMassa,A. J., P. S.Wakenell, andD.L.Brooks. 1992.Mycoplasmasof goats
and sheep. Journal of Veterinary Diagnostic Investigation 4:101–113.
Dassanayake, R. P., S. Shanthalingam, C. N. Herndon, P. K. Lawrence,
E. F. Cassirer, K. A. Potter, W. J. Foreyt, K. D. Clinkenbeard, and S.
Srikumaran. 2009. Mannheimia haemolytica serotype A1 exhibits
differential pathogenicity in two related species, Ovis canadensis and
Ovis aries. Veterinary microbiology 133:366–371.
Foreyt, W. J., V. L. Coggins, and P. Fowler. 1990. Psoroptic scabies in
bighorn sheep inWashington andOregon. Biennial SymposiumNorthern
Wild Sheep and Goat Council 7:135–142.
Foreyt, W. J., and D. A. Jessup. 1982. Fatal pneumonia of bighorn sheep
following association with domestic sheep. Journal of Wildlife Diseases
18:163–168.
Foreyt, W. J., K. P. Snipes, and R. W. Kasten. 1994. Fatal pneumonia
following inoculation of healthy bighorn sheep with Pasteurella haemolytica
from healthy domestic sheep. Journal of Wildlife Diseases 30:137–
145.
Harvey, M. E., D. G. Morrical, and R. F. Rosenbusch. 2007. Sheep flock
infections with Mycoplasma ovipneumoniae involve multiple strains. Small
Ruminant Research 73:287–290.
Johnson, R. L. 1995. Bighorn sheep herd management plan for the
years 1995 to 2000. Washington Department of Fish and Wildlife,
Olympia, USA.
Joseph, M. B., J. R. Mihaljevic, A. L. Arellano, J. G. Kueneman, D. L.
Preston, P. C. Cross, and P. T. J. Johnson. 2013. Taming wildlife disease:
bridging the gap between science and management. Journal of Applied
Ecology 50:702–712.
Kraabel, B. J., M. W. Miller, J. A. Conlon, and H. J. McNeil. 1998.
Evaluation of a multivalentPasteurella haemolytica vaccine in bighon sheep:
protection from experimental challenge. Journal of Wildlife Diseases
34:325–333.
Manlove, K. R., E. F. Cassirer, P. C. Cross, R. K. Plowright, and P. J.
Hudson. 2016. Disease introduction is associated with a phase transition
in bighorn sheep demographics. Ecology 97:In press.
Martin, W. B., and I. D. Aitken. 2000. Mycoplasma respiratory infections.
Pages 198–201 in W. B. Martin, and I. D. Aitken, editors. Diseases of
sheep. Blackwell Science, Oxford, United Kingdom.
McAuliffe, L., R. J. Ellis, R. D. Ayling, and R. A. J. Nicholas. 2003.
Differentiation of Mycoplasma species by 16S ribosomal DNA PCR and
dentaturing gradient gel electrophoresis fingerprinting. Journal of Clinical
Microbiology 41:4844–4847.
Niang, M., R. F. Rosenbusch, J. J. Andrews, J. Lopez-Virella, and M. L.
Kaeberle. 1998a. Occurrence of autoantibodies to cilia in lambs with a
‘coughing syndrome’. Veterinary Immunology and Immunopathology
64:191–205.
Niang, M., R. F. Rosenbusch, M. C. DeBey, Y. Niyo, J. J. Andrews,
and M. L. Kaeberle. 1998b. Field isolates of Mycoplasma ovipneumoniae
exhibit distinct cytopathic effects in ovine tracheal organ cultures. Journal
of Veterinary Medicine Series A 45:29.
Parham, K., C. P. Churchward, L. McAuliffe, R. A. J. Nicholas, and R. D.
Ayling. 2006. A high level of strain variation within the Mycoplasma
ovipneumoniae population of the UK has implications for disease diagnosis
and management. Veterinary Microbiology 118:83–90.
Plowright, R. K., K. R. Manlove, E. F. Cassirer, P. C. Cross, T. E. Besser,
and P. J. Hudson. 2013. Use of exposure history to identify patterns of
immunity to pneumonia in bighorn sheep (Ovis canadensis). PLoS ONE.
8:e61919
Qui~nones-Parra, S., L. Loh, L. E. Brown, K. Kedzierska, and S. A.
Valkenburg. 2014. Universal immunity to influenza must outwit immune
evasion. Frontiers in Microbiology 5:285.
R Core Team. 2015. R: a language and environment for statistical
computing. R Foundation for Statistical Computing, Vienna, Austria.
https://www.R-project.org. Accessed 01 Jul 2016.
Razin, S., D. Yogev, and Y. Naot. 1998. Molecular biology and
pathogenicity of mycoplasmas. Microbiology and Molecular Biology
Reviews 62:1094–1156.
Rifatbegovic, M., Z. Maksimovic, and B. Hulaj. 2011. Mycoplasma
ovipneumoniae associated with severe respiratory disease in goats.
Veterinary Record 168:565.
Rudolph, K. M., D. L. Hunter, W. J. Foreyt, E. F. Cassirer, R. B. Rimler,
and A. C. S. Ward. 2003. Sharing of Pasteurella spp. between free-ranging
bighorn sheep and feral goats. Journal of Wildlife Diseases 39:897–903.
Sirochman,M.A., K. J.Woodruff, J. L. Grigg, D. P.Walsh, K. P. Huyvaert,
M. W. Miller, and L. L. Wolfe. 2012. Evaluation of management
treatments intended to increase lamb recruitment in a bighorn sheep herd.
Journal of Wildlife Diseases 48:781–784.
Subramaniam, R., S. Shanthalingam, J. Bavananthasivam, A. Kugadas,
K. A. Potter, W. J. Foreyt, D. C. Hodgins, P. E. Shfemalen, G. M.
Barrington, D. P. Knowles, and S. Srikumaran. 2011. A multivalent
Mannheimia-Bibersteinia vaccine protects bighorn sheep against Man-
nheimia haemolytica challenge. Clinical and Vaccine Immunology
18:1689–1694.
Sydenstricker, K. V., A. A. Dhondt, D. H. Ley, andG. V. Kollias. 2005. Re-
exposure of captive house finches that recovered from Mycoplasma
gallisepticum infection. Journal of Wildlife Diseases 41:326–333.
Therneau, T. 2015. A package for survival analysis in S. Version 2.38. http://
CRAN.R-project.org/package¼survival. Accessed 01 Jul 2016.
The Wildlife Society. 2015. Domestic sheep and goats disease transmission
risk to wild sheep Joint Issue Statement. http://wildlife.org/wp-
content/uploads/2015/03/WS-DS_DiseaseTransmission_TWS-AAWV_
JointStatement_APPROVED.pdf. Accessed 01 Jul 2016.
Vink, C., G. Rudenko, andH. S. Seifert. 2012.Microbial antigenic variation
mediated by homologous DNA recombination. Fems Microbiology
Reviews 36:917–948.
Walsh, D. P., E. F. Cassirer, M. D. Bonds, D. R. Brown, W. H. Edwards,
G. C. Weiser, M. L. Drew, R. E. Briggs, K. A. Fox, M. W. Miller, S.
Shanthalingam, S. Srikumaran, and T. E. Besser. 2016. Concordance in
diagnostic testing for respiratory pathogens of bighorn sheep. Wildlife
Society Bulletin 40: In press
Western Association of Fish and Wildife Agencies Wild Sheep Working
Group. 2012. Recommendations for domestic sheep and goat manage-
ment in wild sheep habitat. http://www.wildsheepworkinggroup.com/
resources/publications/. Accessed 01 Jul 2016.
Yang, F. L., X. F. Dao, A. Rodriguez-Palacios, X. F. Feng, C. Tang, X. N.
Yang, andH. Yue. 2014. A real-time PCR for detection and quantification
of Mycoplasma ovipneumoniae. Journal of Veterinary Medical Science
76:1631–1634.
Yang, F. L., C. Tang, Y. Wang, H. R. Zhang, and H. Yue. 2011. Genome
sequence of Mycoplasma ovipneumoniae strain SC01. Journal of
Bacteriology 193:5018–5018.
Ziegler, J. C., K. K. Lahmers, G. M. Barrington, S. M. Parish, K. Kilzer, K.
Baker, and T. E. Besser. 2014. Safety and immunogenicity of a
Mycoplasma ovipneumoniae bacterin for domestic sheep (Ovis aries).
PLoS ONE 9:e95698.
Associate Editor: James Cain.